ID: 1016503570

View in Genome Browser
Species Human (GRCh38)
Location 6:144750535-144750557
Sequence TGTCCACTCTTTAAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016503570_1016503574 -9 Left 1016503570 6:144750535-144750557 CCTCCCCACTTAAAGAGTGGACA 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1016503574 6:144750549-144750571 GAGTGGACAATGTAGAAATGAGG 0: 1
1: 0
2: 0
3: 20
4: 198
1016503570_1016503578 15 Left 1016503570 6:144750535-144750557 CCTCCCCACTTAAAGAGTGGACA 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1016503578 6:144750573-144750595 AACCTGAGGGCAAAGCTAATGGG No data
1016503570_1016503575 1 Left 1016503570 6:144750535-144750557 CCTCCCCACTTAAAGAGTGGACA 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1016503575 6:144750559-144750581 TGTAGAAATGAGGAAACCTGAGG No data
1016503570_1016503576 2 Left 1016503570 6:144750535-144750557 CCTCCCCACTTAAAGAGTGGACA 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1016503576 6:144750560-144750582 GTAGAAATGAGGAAACCTGAGGG 0: 1
1: 1
2: 1
3: 27
4: 282
1016503570_1016503577 14 Left 1016503570 6:144750535-144750557 CCTCCCCACTTAAAGAGTGGACA 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1016503577 6:144750572-144750594 AAACCTGAGGGCAAAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016503570 Original CRISPR TGTCCACTCTTTAAGTGGGG AGG (reversed) Intronic
903071950 1:20731129-20731151 TGTCCACTCTTGGAGTTTGGTGG + Intronic
904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG + Intronic
905112762 1:35609159-35609181 TGTCCACTCTTGGAGTTGGGTGG - Intronic
911424277 1:97686961-97686983 TGTCCACTTTTTAATGGGGTTGG - Intronic
911529007 1:99021336-99021358 TGTCCCCTCTTTTTGTGGGGAGG + Intergenic
911631951 1:100193254-100193276 TTTCTATTCTTTAAGTGAGGAGG + Exonic
916528343 1:165631964-165631986 TGCCCCTTCTTTATGTGGGGTGG + Intronic
919945007 1:202312513-202312535 TGTTTACCCTTTAAGTGAGGAGG + Intronic
920124123 1:203680206-203680228 TTTCCATTCTTTTGGTGGGGTGG + Intronic
1064181063 10:13116116-13116138 TGTGCACTGTTTAAACGGGGTGG - Intronic
1065294312 10:24259862-24259884 TCTCCACTCTGGCAGTGGGGAGG - Intronic
1065439230 10:25732654-25732676 TGTCCATTTTTTAATTGGGCTGG + Intergenic
1068061970 10:52079603-52079625 GGTTCACTGTTTAACTGGGGTGG + Intronic
1076589729 10:131574786-131574808 TGTCCACTCCAGAAGTGAGGGGG - Intergenic
1086194409 11:84120085-84120107 TGGCCAGTCTTTCAGTGAGGTGG + Intronic
1090421276 11:126576917-126576939 AGTCCACACTGTAACTGGGGAGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1091775690 12:3183296-3183318 TGTCCCCTCTCAAAGTGGGGAGG + Intronic
1093549149 12:20386458-20386480 TGTCCACTTTTTAATGGGGTTGG + Intronic
1096051201 12:48609801-48609823 TGCCCACTTTTTAATTGGGTTGG + Intergenic
1096084463 12:48856455-48856477 TGTCCACCTTCTATGTGGGGTGG + Intergenic
1097778465 12:63675277-63675299 TGCCCAGTCTCTAAGTAGGGTGG + Intergenic
1102942410 12:116955021-116955043 TTTCCCCTCTTGAAATGGGGGGG + Intronic
1103535754 12:121632962-121632984 TGTCCACCCTTTTAGGAGGGTGG - Intronic
1113392140 13:109908101-109908123 GTTCCACTCTTTAATTTGGGAGG + Intergenic
1115211735 14:30973318-30973340 TGACAACCCTTTAGGTGGGGGGG + Intronic
1117091342 14:52253797-52253819 TGGCCTCTCTTAAAGTTGGGTGG - Intergenic
1119062637 14:71491825-71491847 TGCCAACTCTTCATGTGGGGGGG - Intronic
1120222995 14:81756724-81756746 TATGTACTCTTTTAGTGGGGAGG - Intergenic
1126046230 15:44643136-44643158 TGTGCACTGTTTAAGGGGAGAGG + Intronic
1130121212 15:81049196-81049218 TTTTCAATGTTTAAGTGGGGAGG - Intronic
1130541224 15:84822032-84822054 TCTCCACTCCTTAACTGGGTTGG - Intronic
1134895976 16:17887057-17887079 GGTCCTCTCTGGAAGTGGGGCGG - Intergenic
1138358305 16:56404010-56404032 TGTCCCCTTTTTGAGGGGGGAGG + Intronic
1139656206 16:68388515-68388537 TGCCCTCTCTCTAAGTGGGGAGG + Intronic
1140926718 16:79590404-79590426 TGTCTACACTTAAAGTGGGGCGG + Intronic
1141014835 16:80439255-80439277 TGTCCACCCTTTAATGGGGAAGG - Intergenic
1143341734 17:6216343-6216365 TGACCACTCTTTAGCTGGGAGGG + Intergenic
1150229792 17:63543752-63543774 TCTCCACTCATGGAGTGGGGTGG - Intronic
1150514118 17:65789815-65789837 TGACAACTCTTTAAGGGGAGGGG + Intronic
1151474812 17:74339457-74339479 GGTCCCCTCTTTCAGTGGGAGGG - Intronic
1151474831 17:74339516-74339538 GGTCCCCTCTTTCAGTGGGAGGG - Intronic
1151474850 17:74339575-74339597 CGTCCCCTCTTTCAGTGGGAGGG - Intronic
1154324913 18:13383028-13383050 TCTCAACTCTTCTAGTGGGGTGG + Intronic
1156366444 18:36431756-36431778 TGACCATCCTTTAAGTGGGAAGG + Intronic
1157149429 18:45201286-45201308 TCCCCACTCTTTAAGTGGGCTGG - Intergenic
1161975659 19:7606642-7606664 TGGACACTCCTGAAGTGGGGAGG + Intronic
927836722 2:26404859-26404881 TGTCCTCACTCTAAGTGGGTGGG + Intronic
927862118 2:26566616-26566638 TGTCCACTCTATCTGTGGGGTGG - Intronic
931943692 2:67281642-67281664 TGACCACTCTTTTGGTGTGGAGG - Intergenic
932466722 2:71928878-71928900 TGCCCTCTCTTTAAGTGGAGGGG - Intergenic
933941364 2:87247693-87247715 TGCCCACTCTTTACCTGGAGGGG + Intergenic
935824618 2:106932640-106932662 TGTGCAGTCTTTGACTGGGGAGG + Intergenic
936338858 2:111613895-111613917 TGCCCACTCTTTACCTGGAGGGG - Intergenic
938871297 2:135479758-135479780 TGTCCCCTCTTCAAGCAGGGTGG - Intronic
939679184 2:145109247-145109269 TTTCTTCTCTTGAAGTGGGGAGG - Intergenic
942696366 2:178651419-178651441 TGTCCACTGTTTGATGGGGGCGG - Intronic
1170626451 20:18033711-18033733 TGACCACCCTTTGAGTAGGGAGG + Intronic
1171873483 20:30549306-30549328 TGACCACTCTTATAGTGGGGAGG + Intergenic
1172503883 20:35446785-35446807 AGTCCTCTCTTTACGTGGGAAGG - Intronic
1174872975 20:54200733-54200755 TGTGCGCTCTGTGAGTGGGGGGG + Intergenic
1182787342 22:32918821-32918843 TGTCCCCACTTCAGGTGGGGAGG + Intronic
1184171114 22:42760379-42760401 TGTCTCCTCTTTCAGTGTGGAGG + Intergenic
949549379 3:5099605-5099627 TGTCCCCTCCTTCAGTGTGGTGG - Intergenic
950458335 3:13105805-13105827 TGTCCCCTCTCCATGTGGGGAGG + Intergenic
951908922 3:27729641-27729663 TGTCCACTCTCTAAGTGCTGGGG + Intergenic
958868908 3:99533881-99533903 TCTCCTCTCTTTAAGGGGAGGGG - Intergenic
963381937 3:144541436-144541458 TGTCCACTTTTTAATGGGGTTGG - Intergenic
965904569 3:173687830-173687852 TGTTCACTTTTTAATTTGGGAGG - Intronic
969133913 4:5014411-5014433 TGTCTGCTCTTTAAGTGTTGGGG - Intergenic
970526287 4:16935433-16935455 TGTCTACTTTTTAAGGAGGGTGG - Intergenic
972691612 4:41404213-41404235 TGACCACCCTTACAGTGGGGAGG + Intronic
977412358 4:96684243-96684265 TGCCCACTTTTTAATGGGGGTGG + Intergenic
985190622 4:187368800-187368822 TGTATAGGCTTTAAGTGGGGTGG + Intergenic
995424288 5:112003031-112003053 CGTCTTCTCTTTAAGTGGGAAGG + Intergenic
997625551 5:135328460-135328482 TGACCATTCTGTCAGTGGGGAGG - Intronic
998729920 5:145062915-145062937 TGTACACTCTGTGTGTGGGGAGG + Intergenic
1000204018 5:159040037-159040059 TGTGGAGTCTTTAAGTGAGGTGG - Intronic
1003560410 6:7175347-7175369 TGTGCATTGTTTCAGTGGGGTGG + Intronic
1008527993 6:52426767-52426789 TGGCAACTCATTAAGTGTGGAGG - Intronic
1015612827 6:135044267-135044289 TTTCCACTCTATAGGTGGAGTGG + Intronic
1016305758 6:142681866-142681888 CGTTAAGTCTTTAAGTGGGGAGG + Intergenic
1016503570 6:144750535-144750557 TGTCCACTCTTTAAGTGGGGAGG - Intronic
1019176489 6:170161898-170161920 TCTCCACTTTTTAAATGGGGAGG + Intergenic
1022937398 7:35192945-35192967 TGCCCAGTCTCTAAGTAGGGTGG + Intergenic
1024439787 7:49403831-49403853 TTTCCTCTCTTTAAGAGGTGAGG + Intergenic
1025962724 7:66237704-66237726 TGCCCACTCTGTATATGGGGAGG + Intronic
1026366036 7:69649415-69649437 TGTCCACTCTTTAAGAGTTAAGG - Intronic
1028372727 7:90112657-90112679 TGCCCAGTCTCTAAGTAGGGTGG - Intergenic
1029833560 7:103285589-103285611 TGCCCAGTCTCTAAGTAGGGTGG + Intergenic
1031651495 7:124296346-124296368 TGTACATTTCTTAAGTGGGGTGG + Intergenic
1035344104 7:158186976-158186998 TGTCCACTCTGTTACTGAGGAGG - Intronic
1036984374 8:13510685-13510707 TTTCCACATTTTAAATGGGGTGG - Intronic
1038239963 8:25799216-25799238 TGTCCACCCATAAAGTGGGCAGG + Intergenic
1053329638 9:37191496-37191518 TATCCACCATTTTAGTGGGGTGG - Intronic
1055607267 9:77983801-77983823 ATTCCACTCTTTTAGTGGGGAGG + Intronic
1187482660 X:19672323-19672345 TCCCCACTCTTTAAGTGGGAGGG + Intronic
1187640867 X:21287917-21287939 GGTCCACTTTTTAATTGGGTTGG + Intergenic
1190436558 X:50431414-50431436 TGTCTACTTTTTGAGTGGGTGGG - Intronic
1192343647 X:70283688-70283710 TGTCCTCTATTTACTTGGGGAGG + Intronic
1198607848 X:138363006-138363028 TATTCACTTTTTAAGTGGGCAGG + Intergenic
1199216594 X:145266253-145266275 TGTACACTCATCAACTGGGGTGG - Intergenic
1201299936 Y:12496743-12496765 TGTCCACTATTTAAGCAGGCTGG - Intergenic