ID: 1016510013

View in Genome Browser
Species Human (GRCh38)
Location 6:144831790-144831812
Sequence CAGTGTCACCCAAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016510013_1016510022 16 Left 1016510013 6:144831790-144831812 CCATCTGCCCTTGGGTGACACTG 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1016510022 6:144831829-144831851 AGGCTGACTGTGGTTTACACAGG No data
1016510013_1016510018 -8 Left 1016510013 6:144831790-144831812 CCATCTGCCCTTGGGTGACACTG 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1016510018 6:144831805-144831827 TGACACTGGAAAGAAAGAATGGG No data
1016510013_1016510020 -4 Left 1016510013 6:144831790-144831812 CCATCTGCCCTTGGGTGACACTG 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1016510020 6:144831809-144831831 ACTGGAAAGAAAGAATGGGGAGG 0: 1
1: 0
2: 4
3: 48
4: 643
1016510013_1016510017 -9 Left 1016510013 6:144831790-144831812 CCATCTGCCCTTGGGTGACACTG 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1016510017 6:144831804-144831826 GTGACACTGGAAAGAAAGAATGG 0: 1
1: 0
2: 3
3: 59
4: 706
1016510013_1016510019 -7 Left 1016510013 6:144831790-144831812 CCATCTGCCCTTGGGTGACACTG 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1016510019 6:144831806-144831828 GACACTGGAAAGAAAGAATGGGG 0: 1
1: 0
2: 4
3: 61
4: 572
1016510013_1016510021 6 Left 1016510013 6:144831790-144831812 CCATCTGCCCTTGGGTGACACTG 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1016510021 6:144831819-144831841 AAGAATGGGGAGGCTGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016510013 Original CRISPR CAGTGTCACCCAAGGGCAGA TGG (reversed) Intronic
900078965 1:841408-841430 CCTTGGCACCCAAGAGCAGAGGG - Intergenic
900422423 1:2561336-2561358 CAGTGGCAGACAAGGACAGAAGG - Intronic
900567822 1:3342641-3342663 CAATATCCCCCAAGGGCAAATGG + Intronic
900636365 1:3667931-3667953 CAGTGTCCCCCCAGGGCTCATGG + Intronic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
903220085 1:21864619-21864641 GAGTGTGTCCCAAGGGCACACGG - Intronic
904684564 1:32251071-32251093 CAGTGTCACCCTGGGACAGTAGG + Intergenic
905467162 1:38163886-38163908 CAATGTCCCCAAAGGGCAGATGG + Intergenic
905472128 1:38201139-38201161 CCGTGTCATCCCATGGCAGAAGG + Intergenic
906103222 1:43276361-43276383 GGGTGGGACCCAAGGGCAGAGGG - Intergenic
907962064 1:59293391-59293413 CTGTGTCATCCCATGGCAGAAGG + Intergenic
909527594 1:76644195-76644217 CAGAGTCATCCCATGGCAGAAGG + Intergenic
917046565 1:170867040-170867062 CATTGTCAACCGAGGGCACATGG - Intergenic
918708492 1:187697532-187697554 CAGTGTCTTCCAGTGGCAGAAGG - Intergenic
919344997 1:196363677-196363699 CTGTGTCATCCCATGGCAGAAGG - Intronic
919582144 1:199389581-199389603 CAGCCTGACCCAAGGACAGATGG - Intergenic
919612596 1:199763869-199763891 ATGTGTCACCCAAGGGGAAAAGG - Intergenic
921648091 1:217643450-217643472 CAGTGTGTCCCATGGACAGAAGG - Intronic
921970422 1:221142503-221142525 CAGTTTCAGCCAGGGGAAGAAGG + Intergenic
922045863 1:221945861-221945883 CAGTGCCACCCCAGGCCACAAGG + Intergenic
922823562 1:228501662-228501684 CAGTGTGACCCAAGGCCACCAGG + Intergenic
923618819 1:235560413-235560435 CAGTGTCACCCCACAGCAGATGG - Intronic
1063343592 10:5291816-5291838 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1064066028 10:12182180-12182202 CAGTGTCCCCCCAGGGGAAAAGG - Intronic
1064347209 10:14543185-14543207 CAGTGTCACCCAGTGGTAAAAGG + Intronic
1065640198 10:27774278-27774300 CTGTGTCATACAATGGCAGAAGG + Intergenic
1067064737 10:43097340-43097362 CACGGCCACCCAAGGGCAAATGG + Intronic
1067312410 10:45126589-45126611 CAGTGCAACCCAAGGCCAGCGGG - Intergenic
1068065003 10:52119844-52119866 CTGTGTTATCCAATGGCAGAAGG + Intronic
1069372193 10:67760131-67760153 AAGTTTCATCCAATGGCAGAGGG + Intergenic
1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG + Intronic
1070919255 10:80173724-80173746 CAGAGACACCCAATGGCAGGCGG + Intronic
1072488587 10:95880460-95880482 CAATGTCTCCCAAGAGGAGATGG - Intronic
1072762489 10:98068441-98068463 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1073375015 10:103026067-103026089 CTGTGTCATCCCATGGCAGAAGG - Intronic
1073586814 10:104718268-104718290 CTGTGTCATCCCATGGCAGAAGG + Intronic
1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG + Intergenic
1074644784 10:115435402-115435424 CTGTGTCATCCCATGGCAGAAGG - Intronic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1076680513 10:132169117-132169139 CAGCGTCACGCATGTGCAGACGG - Intronic
1077137588 11:1008911-1008933 CAGTGTCACCCACAGACAGGAGG - Intronic
1077366662 11:2163975-2163997 CAGTGTCAGGGAAGGGCGGAGGG + Exonic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1079241857 11:18727315-18727337 GGGGGTCACCCCAGGGCAGAAGG - Intergenic
1082040727 11:47682694-47682716 AAGTGACACACAAGGGCTGAGGG - Intronic
1082776912 11:57252512-57252534 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1083272263 11:61578518-61578540 CAGTACCAGCCAAGGGGAGATGG + Intronic
1083280284 11:61622598-61622620 CTGTCTCAGCCAAGGGGAGAGGG + Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084723341 11:70923969-70923991 CAGTGTCTCACAAGGGCACTGGG - Intronic
1086210221 11:84309250-84309272 CAGTGATTCCCAAGGACAGACGG - Intronic
1088719854 11:112582793-112582815 CACTATCACCCAAGGGGTGATGG - Intergenic
1089332445 11:117699412-117699434 CGATGTCACCCCAGAGCAGAGGG + Intronic
1091748486 12:3008244-3008266 CAGTGGCACCCAAGGGGTGCAGG + Intronic
1092200249 12:6577547-6577569 CAGTGACACACTAGTGCAGAGGG - Intronic
1095967752 12:47880263-47880285 CTCTGTCACCCAAGGGCAGGAGG - Intronic
1098659564 12:73075377-73075399 CAGTGTCACAGAGGTGCAGATGG - Intergenic
1099315591 12:81078603-81078625 CAGGGTCTCTCAAGAGCAGAAGG - Intronic
1100232548 12:92623021-92623043 CTGTGTCACCCCATGGCAGAAGG - Intergenic
1100234052 12:92639844-92639866 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1103862496 12:124025986-124026008 CAGTCTCATCCAAGGACAGTGGG + Intronic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1105686680 13:22790141-22790163 AAGTCTCACCTGAGGGCAGATGG + Intergenic
1105948671 13:25210713-25210735 CTGTGTGACCCTAGGGCAGGAGG + Intergenic
1107157008 13:37179565-37179587 CAGTGTTTGCCAGGGGCAGATGG - Intergenic
1107260546 13:38485418-38485440 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1110304371 13:73968017-73968039 CTGTTTCACCATAGGGCAGAAGG - Intronic
1113197291 13:107823380-107823402 AAATGTCAGCCAGGGGCAGAGGG - Intronic
1113585026 13:111459002-111459024 CAGTGTCACCCATGAACCGATGG - Intergenic
1114575599 14:23710160-23710182 CAATCTCACCCATAGGCAGAGGG - Intergenic
1114639144 14:24207410-24207432 TGGTGTCATCAAAGGGCAGATGG - Exonic
1116441923 14:44963319-44963341 TAGTGTCTCCTCAGGGCAGAGGG - Exonic
1117293244 14:54353838-54353860 CATGGGCACACAAGGGCAGAGGG - Intergenic
1117772708 14:59150978-59151000 CAGTATCTACCAAGGTCAGAAGG + Intergenic
1118782563 14:69018671-69018693 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1119556489 14:75557402-75557424 CAGGGTCATCCCATGGCAGAAGG + Intergenic
1120253611 14:82090527-82090549 CAGTGTCAGCTAATGGTAGAAGG + Intergenic
1120701954 14:87707706-87707728 CATAGTCACAAAAGGGCAGAAGG + Intergenic
1121359427 14:93243011-93243033 CACTGTCACTCAAGGACAGGAGG - Exonic
1122191198 14:100045107-100045129 CAGTGGCTCCCAACTGCAGACGG - Intronic
1122638058 14:103139349-103139371 CAGCGCCCCCGAAGGGCAGAGGG - Intergenic
1122792570 14:104190543-104190565 GAGGGTCCCCCCAGGGCAGATGG + Intergenic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1128342882 15:66835025-66835047 CAGTGTCACCCAAAGCCACGAGG + Intergenic
1130766629 15:86877648-86877670 CATTGTCTCCCAGGGTCAGAGGG - Intronic
1130877704 15:88028707-88028729 CAAGGACACCCAAGGACAGAAGG + Intronic
1131224272 15:90611137-90611159 GAGTGTCACCCAGGGACAGGAGG + Intronic
1132618778 16:854797-854819 CAGGGTCCCCCACGGACAGAGGG + Intronic
1132621909 16:871763-871785 CTGTGTCACCCATCGGCTGAGGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1135650296 16:24200624-24200646 CTGTGTCATCCCATGGCAGAAGG + Intronic
1136248877 16:28990593-28990615 CAGTGCCAGCCCAGGTCAGAAGG - Exonic
1137444201 16:48522046-48522068 CAGCTTTACCCAGGGGCAGATGG + Intergenic
1140955180 16:79856855-79856877 TAGTGTGACCCATGGACAGAAGG - Intergenic
1141257962 16:82421140-82421162 CAGTGTCAGCAAAGGGCTAAGGG - Intergenic
1143037701 17:4009154-4009176 CCTGGTCACCCAAGGGCAGGTGG - Intronic
1143932861 17:10448828-10448850 CAGTTTCCCCCAAGGGGAGCTGG + Intronic
1145218858 17:21072460-21072482 CAGATTCAACCAAGGGCAGATGG - Intergenic
1147437699 17:40427723-40427745 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1147944937 17:44075596-44075618 GAGTGGGCCCCAAGGGCAGATGG + Intronic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1151427646 17:74041466-74041488 CATTCTCACCCCAGGGGAGATGG + Intergenic
1151448199 17:74180991-74181013 CATCGTCACCCAAGAGCAGGAGG + Intergenic
1152191284 17:78889577-78889599 CAGGGGCACCCAAGGTCAGACGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157443228 18:47725830-47725852 GGGTGTCACCCAGGAGCAGAGGG - Intergenic
1157585214 18:48796673-48796695 CACAGCCACCCAAGGGCAGAAGG + Intronic
1159454598 18:68644707-68644729 CAGTGTCATCCCATGGCAGAAGG - Intergenic
1160103058 18:75941892-75941914 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1160430024 18:78804642-78804664 CAATGGCAGCCAGGGGCAGAGGG + Intergenic
1162373594 19:10292646-10292668 CAGCGTCTCCGAGGGGCAGATGG + Exonic
1163804615 19:19387890-19387912 CAGTGTCTCCCATCGGGAGACGG - Intronic
1163860274 19:19739136-19739158 CACTGTCACCCTAGGGCCCATGG - Intergenic
1165774632 19:38397334-38397356 TAGGGTCACTCAAGGGCTGAGGG - Intergenic
1166891732 19:45998231-45998253 TTGTGGCGCCCAAGGGCAGAAGG + Intronic
927484226 2:23477859-23477881 CAGAGACACCCCAGGGCAGTGGG + Intronic
927776373 2:25906997-25907019 GAGGGTCACCCCATGGCAGAAGG - Intergenic
928368923 2:30724776-30724798 GACTGACACCCCAGGGCAGATGG - Intronic
930746845 2:54893371-54893393 CTGTGTTACCCAATGGCTGAAGG + Intronic
932412558 2:71555916-71555938 GTGTGTCACCACAGGGCAGAGGG - Intronic
932790364 2:74649632-74649654 CTGTGTCATCCCATGGCAGAAGG + Intergenic
932797495 2:74709743-74709765 CTGTGTCATCCCATGGCAGAAGG + Intergenic
935617817 2:105103624-105103646 GATCGTCACACAAGGGCAGATGG - Intergenic
936938980 2:117863431-117863453 CAGAGACACCCATGAGCAGAGGG - Intergenic
937380323 2:121370772-121370794 CAGTGTCACCTAGGGACAGGTGG - Intronic
938119703 2:128624930-128624952 CTTTGTCACCAAAGAGCAGAGGG - Intergenic
939204649 2:139085128-139085150 CACTTTCAGCCAAGGTCAGATGG - Intergenic
939575809 2:143893336-143893358 AAGTGTCACCCAGAGGCAAAAGG - Intergenic
940174730 2:150865448-150865470 CTGTGTCATCCCATGGCAGAAGG + Intergenic
941473570 2:165920899-165920921 CAGTTTCACTCAAGGGAAGTTGG - Intronic
942482058 2:176399136-176399158 CAGTGTAAGCCAAAGGCAGTGGG + Intergenic
943539378 2:189193034-189193056 CTGTGTCATCCCATGGCAGAAGG - Intergenic
943955743 2:194187319-194187341 CAGTGGCATCCACAGGCAGAAGG - Intergenic
944301591 2:198130384-198130406 CTGTGTCCCCCAGGGACAGAAGG - Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
948494721 2:238340019-238340041 CACTGCCACCCAAGGACAGCGGG - Intronic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948742153 2:240055187-240055209 CAGTGACAACCAAGAGCAGAAGG + Intergenic
1169027533 20:2383319-2383341 TGGTATCACCCAAGGGCAGGAGG + Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169229185 20:3875740-3875762 CAAGGACACCCAAGGGCAGAGGG - Exonic
1170014028 20:11760641-11760663 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1170794625 20:19535908-19535930 CTGTGTCATCCCATGGCAGAAGG + Intronic
1171181125 20:23091444-23091466 GAGCCTCCCCCAAGGGCAGACGG - Intergenic
1171212560 20:23328003-23328025 CAGTGCAACGCAAGGGAAGAGGG + Intergenic
1171544630 20:25990751-25990773 TGATGTCACCCAAGAGCAGATGG - Intergenic
1172033471 20:31996740-31996762 CTGGGTCATCCAAGGGGAGACGG + Exonic
1172665820 20:36599043-36599065 CAGTGTAGCCCAAGGTCATAAGG - Intronic
1175109770 20:56639486-56639508 CAGTGTCTCTCAACTGCAGAGGG + Intergenic
1175648820 20:60698913-60698935 CAGCGGCACCCAAGGCCAAAGGG - Intergenic
1178356467 21:31913675-31913697 CATTGGCACTCATGGGCAGATGG + Intronic
1179532301 21:42028239-42028261 CACTGTCACCGAAGTCCAGATGG + Intergenic
1181296477 22:21844045-21844067 CTGTATCACCCCATGGCAGAAGG + Intronic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1184741658 22:46432072-46432094 CAGTGCCAACCCAGGGCAGGTGG - Intronic
1185099574 22:48830443-48830465 AAACATCACCCAAGGGCAGAGGG + Intronic
1185270227 22:49926573-49926595 CAGGGCCAGCCCAGGGCAGAGGG - Intronic
949965882 3:9355860-9355882 CTATGTCACCCCACGGCAGAAGG + Intronic
953144366 3:40260845-40260867 CTGTGTCATCCCATGGCAGAAGG + Intergenic
953346190 3:42177949-42177971 GAGTGACACCCAAAGGCTGAAGG - Intronic
953711399 3:45274029-45274051 CTATGTATCCCAAGGGCAGAGGG + Intergenic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954295285 3:49671063-49671085 CAGTGCCACCCCAGTGCACATGG - Exonic
954998287 3:54902075-54902097 CAGTGTGCCCCAACAGCAGATGG + Intronic
955014920 3:55060946-55060968 CATTGTCAGCCCAAGGCAGATGG - Intronic
955026919 3:55176639-55176661 CTGTGTCATCCCATGGCAGATGG + Intergenic
956587743 3:70882415-70882437 CAGTCTGAAACAAGGGCAGAAGG - Intergenic
957955532 3:87181806-87181828 CAGTGTTAAGCAAGAGCAGATGG - Intergenic
961008601 3:123421591-123421613 CATTGTCACCCAAGGGTGGGTGG + Intronic
962440665 3:135412742-135412764 CTGTGGCAGCCAAGGGCAGGTGG - Intergenic
963271866 3:143292836-143292858 CAGTGTCATCAACGTGCAGAGGG - Intronic
966338706 3:178901274-178901296 CTGTGTCATCCCATGGCAGAAGG - Intergenic
966393234 3:179475019-179475041 CTGTGTCATCCAATGGCAGGAGG + Intergenic
967119635 3:186371388-186371410 CCATGTCACACAAGGGCAGATGG - Intergenic
967380517 3:188852628-188852650 CTGTGTCATTCCAGGGCAGAAGG - Intronic
968047270 3:195631360-195631382 CAGCCTCACCCAAGGGCAGTTGG + Intergenic
968307343 3:197658564-197658586 CAGCCTCACCCAAGGGCAGTTGG - Intergenic
968452048 4:680441-680463 CCGTGGCTGCCAAGGGCAGATGG - Intronic
969993819 4:11291405-11291427 CTGTGTCACGCTATGGCAGAAGG - Intergenic
971302739 4:25455451-25455473 CTGTGTCATCCAGTGGCAGAAGG + Intergenic
973706777 4:53588896-53588918 CAAGGTCACCCAAGGGCACAGGG + Intronic
974382485 4:61159375-61159397 CTGTGTCATCCCATGGCAGACGG + Intergenic
974796338 4:66755815-66755837 CAGTGTCATCCCATGGCAGAAGG - Intergenic
975464468 4:74693857-74693879 CAGTGTAATCTAAGAGCAGAAGG + Intergenic
976504574 4:85832104-85832126 CAGGGTCAGTCAGGGGCAGAGGG + Intronic
977706778 4:100080428-100080450 CTGTGCCATCCAATGGCAGAAGG + Intergenic
984813140 4:183813041-183813063 CAGATTCAGCCAATGGCAGATGG + Intergenic
985599849 5:821852-821874 CAAACTCACCCAAGTGCAGATGG + Exonic
985717755 5:1472147-1472169 GAGGAGCACCCAAGGGCAGAGGG + Intronic
986162837 5:5246882-5246904 CATTGTCACACATGGGCATATGG - Intronic
989277392 5:39605328-39605350 CTGAGTCATCCCAGGGCAGAAGG + Intergenic
993950689 5:94171215-94171237 GAGTCTCACACAAGGTCAGATGG + Intronic
994108604 5:95975046-95975068 CAGTGGCATGCATGGGCAGAAGG + Intergenic
994142139 5:96353658-96353680 CACTGCTATCCAAGGGCAGAAGG - Intergenic
994153236 5:96473910-96473932 CAGTGTCCTCCCAGTGCAGAGGG + Intergenic
994626463 5:102226252-102226274 CAGTGTCTGCCAAGAGAAGATGG - Intergenic
997043855 5:130289997-130290019 TAGCCTCACCCAAGGCCAGATGG - Intergenic
997234803 5:132266579-132266601 CAGAGTGAGCCCAGGGCAGAGGG + Intronic
997530702 5:134579641-134579663 CTGTGTCACCCAGTGGCAGTGGG - Exonic
997735637 5:136210670-136210692 GAGAGAGACCCAAGGGCAGATGG - Intergenic
998095652 5:139394411-139394433 CAGAGTCCCCCAAGGGCGGCCGG - Exonic
999371553 5:151058457-151058479 CAGTGTTACCCTACTGCAGACGG + Intronic
1000129034 5:158276943-158276965 CAGTGTGAACCAAGGCCTGAAGG + Intergenic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1003965209 6:11246374-11246396 CAGTGACAGGCAAAGGCAGATGG + Intronic
1006247132 6:32747145-32747167 CATTCTGAGCCAAGGGCAGAGGG - Exonic
1007038187 6:38697424-38697446 GAGAATCACCCTAGGGCAGAAGG + Intronic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1010571860 6:77482976-77482998 CAGAGCCATCCAAGGGCTGAAGG + Intergenic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1012286444 6:97395448-97395470 CATTGTCAAGGAAGGGCAGATGG - Intergenic
1012496144 6:99835577-99835599 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1012937500 6:105383562-105383584 CCTTTTCACCCAAGAGCAGATGG - Intronic
1014559185 6:122870405-122870427 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1015403809 6:132815135-132815157 AACTGCCACCCAAGGGAAGAAGG + Intronic
1016510013 6:144831790-144831812 CAGTGTCACCCAAGGGCAGATGG - Intronic
1016563216 6:145420790-145420812 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1017206340 6:151807863-151807885 CCGTGTCCCCGCAGGGCAGAAGG - Exonic
1019729967 7:2624179-2624201 CAGGGTCCCCCAAGGGGACATGG + Intergenic
1023829108 7:44028926-44028948 CTGTGGCACCCAAGGGTAGCGGG + Intergenic
1024968977 7:55051493-55051515 CTGTGTCACCCCACGGCAGAAGG - Intronic
1025296018 7:57775816-57775838 TGATGTCACCCAAGAGCAGACGG - Intergenic
1027595384 7:80167364-80167386 CAGTGTCACAAAAGTGAAGATGG + Intronic
1027948649 7:84783626-84783648 GAGTGTCACCCAGGGCCTGAAGG + Intergenic
1028446942 7:90935076-90935098 CTGTGTCATCCAAGGGCAGCAGG + Intronic
1029372473 7:100158370-100158392 CAGTCTCCCCCAAGTACAGATGG + Exonic
1029556908 7:101276707-101276729 CAGTGACACCCACAGGCAGAAGG + Intergenic
1029691185 7:102183112-102183134 GAGAGACACCCAAGGCCAGAGGG - Intronic
1029739409 7:102483183-102483205 CTGTGGCACCCAAGGGTAGCGGG + Exonic
1029757410 7:102582362-102582384 CTGTGGCACCCAAGGGTAGCGGG + Exonic
1029775350 7:102681423-102681445 CTGTGGCACCCAAGGGTAGCGGG + Intergenic
1029952582 7:104602825-104602847 CTGTGTCATCCCATGGCAGAAGG + Intronic
1030896558 7:115068377-115068399 CAGTGTTTGCCAAGGGCAGGAGG + Intergenic
1030897497 7:115079028-115079050 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1031116612 7:117675900-117675922 CTGTGTCATCCCATGGCAGAAGG - Intronic
1033616823 7:143024329-143024351 CTGTGTCATCCTATGGCAGAAGG - Intergenic
1034452427 7:151144145-151144167 CAATGGCACCTTAGGGCAGAGGG - Exonic
1036679420 8:10860157-10860179 CCGTGTTAGCCAAGGGAAGAGGG - Intergenic
1038402081 8:27291793-27291815 CTGTGTCATCCCATGGCAGAAGG + Intronic
1038834894 8:31108695-31108717 CAGTGTTACACAAGGGCCAAAGG + Intronic
1039211359 8:35218642-35218664 AAGTGTCATCCCAAGGCAGAAGG - Intergenic
1042076606 8:65002204-65002226 CTGTGTCATCCAAGAGCAGAAGG + Intergenic
1043480542 8:80648018-80648040 CTGTGTCATCCCAGGGCAAAGGG + Intronic
1043506916 8:80911327-80911349 CAGCGTCTCACAAGGGCAAAAGG + Intergenic
1044017354 8:87060014-87060036 AGGAGTCACCCCAGGGCAGAGGG - Intronic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1044760404 8:95511629-95511651 CTGTGTCACCTCATGGCAGAAGG - Intergenic
1044925842 8:97208164-97208186 CAGGGTCATTCTAGGGCAGAGGG + Intergenic
1045479694 8:102582115-102582137 CAGAGTCACCAAAAGGCAAAGGG - Intergenic
1046876519 8:119260597-119260619 AAGTGACCCCCAAGTGCAGAAGG - Intergenic
1047766326 8:127992855-127992877 CGGTGTCACCAAAGGCCAGGAGG - Intergenic
1047803284 8:128332047-128332069 TAGGGTCACACATGGGCAGAGGG + Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049657385 8:143804846-143804868 CAGGGAGGCCCAAGGGCAGAAGG + Intronic
1049782745 8:144436263-144436285 CAGGGTCTCCCCAGGGCAGGCGG - Exonic
1050019766 9:1270720-1270742 CAGAATCTCCTAAGGGCAGAAGG - Intergenic
1051873522 9:21766833-21766855 CTGTGTCACCTCATGGCAGAAGG + Intergenic
1051877412 9:21806729-21806751 CAGCATCAGCCAAGGGCAGGTGG + Intronic
1052690881 9:31815523-31815545 GTGTGTCACCTAAGGCCAGATGG - Intergenic
1053389345 9:37723095-37723117 AAATATCACCAAAGGGCAGAGGG - Intronic
1054884172 9:70178007-70178029 CAGTGTAACCCCAGGGCTGTAGG + Intronic
1055545732 9:77371382-77371404 CGGTGTCATCCCATGGCAGAAGG + Intronic
1055840109 9:80493519-80493541 CTGTGTCATCCCAGGGCAGAAGG + Intergenic
1056777499 9:89524286-89524308 CCGTGTCAGCCAAGAGCAAAGGG + Intergenic
1056795412 9:89655571-89655593 CACTGGCAGCCAAGGGCAGGAGG - Intergenic
1058061737 9:100504397-100504419 CAGTGTCACCAAGTGACAGATGG + Intronic
1060664160 9:125423069-125423091 CAGTGTCACTCTTGGGCACACGG + Intergenic
1061890139 9:133614966-133614988 CTGTGTCACCCAGGGGCGGTGGG + Intergenic
1187334588 X:18371119-18371141 CAGGGTCATCCCATGGCAGAAGG - Intergenic
1187550002 X:20293052-20293074 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1187685317 X:21810269-21810291 CTGTGTCTCCCCATGGCAGAAGG + Intergenic
1187944647 X:24414446-24414468 CTGTGTCATCCCACGGCAGAAGG - Intergenic
1189582131 X:42417768-42417790 CTGTGTCATCCCATGGCAGAAGG + Intergenic
1192279343 X:69667834-69667856 CTGTGTCACTCCATGGCAGAAGG + Intronic
1193507607 X:82363016-82363038 CAGGGGCAGCCAAGGGCACATGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194495541 X:94613068-94613090 CACTGTCACCCCAGGCCATAAGG + Intergenic
1195168015 X:102239352-102239374 CTGTGTCATCCAATGGCAGAAGG + Intergenic
1195190842 X:102447735-102447757 CTGTGTCATCCAATGGCAGAAGG - Intronic
1196281991 X:113832861-113832883 CTGTGTCCTCCCAGGGCAGAAGG + Intergenic
1198398821 X:136250906-136250928 CACCGCCCCCCAAGGGCAGATGG + Intronic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1200274754 X:154721394-154721416 CTGTGTCACCCCATAGCAGAAGG + Intronic
1200382979 X:155859130-155859152 CTGTGTCATCCCATGGCAGAAGG - Intergenic
1200392350 X:155956847-155956869 AAGTGTCAGCCAATGGCAGGCGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic