ID: 1016510361

View in Genome Browser
Species Human (GRCh38)
Location 6:144835938-144835960
Sequence GGTGTGCTAGGCCTGGGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016510357_1016510361 -6 Left 1016510357 6:144835921-144835943 CCTGGAGGAAGAACAAAGGTGTG 0: 1
1: 0
2: 1
3: 28
4: 339
Right 1016510361 6:144835938-144835960 GGTGTGCTAGGCCTGGGAGAAGG 0: 1
1: 1
2: 0
3: 38
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016510361 Original CRISPR GGTGTGCTAGGCCTGGGAGA AGG Exonic
900595109 1:3476987-3477009 GGTGGACCAGGCCTGGGAGGGGG - Intronic
900758398 1:4454062-4454084 GGTGTGGGAGGGCTGGGAGCGGG - Intergenic
900795031 1:4702690-4702712 GGTGTGCTGGGGCAGGGAGGAGG + Intronic
900926887 1:5711535-5711557 GGTGTGAGGGCCCTGGGAGAGGG - Intergenic
900947598 1:5840188-5840210 GCTGTGCTGGGCCTGGCAGGGGG + Intergenic
901797384 1:11688162-11688184 GGTCACCTGGGCCTGGGAGAGGG - Intronic
901866481 1:12110046-12110068 GGTGGGCTTGGCCTGGGGGATGG - Exonic
902209443 1:14894171-14894193 GGTGAGCTAGGGAGGGGAGATGG - Intronic
902394568 1:16125484-16125506 GGTTAGGTAGGCCTGGGAGAAGG + Intronic
903316648 1:22513089-22513111 GGTGTGATAGGCCAGGGCGGAGG - Exonic
903333532 1:22609791-22609813 TGTGTGCTGGGGCTGGGAGGAGG + Intergenic
903463384 1:23534852-23534874 GGTAAGCAAAGCCTGGGAGATGG - Intergenic
903780121 1:25815537-25815559 GATGTGATGGACCTGGGAGAAGG - Exonic
905296229 1:36956092-36956114 GGGGTGCTCGGCCTGGGGGACGG + Intronic
907801630 1:57771752-57771774 GGTGTCCTGGGGCTGGGAGTTGG - Intronic
907875509 1:58483167-58483189 GATAAGCTAGGGCTGGGAGAGGG - Intronic
908514642 1:64880113-64880135 GGTGTGCTGGGCCAGGGAGGGGG - Intronic
910069218 1:83191115-83191137 GGTGTGTGAGGCAAGGGAGATGG + Intergenic
910937837 1:92500477-92500499 GGTATGCTGGCCCTGGGAGAGGG + Intergenic
912772367 1:112476574-112476596 GCTGTGCTTGGACTGGGGGATGG - Intronic
917797954 1:178545368-178545390 GCTGTCCTGGGCCTGGAAGACGG - Intronic
919144848 1:193621156-193621178 GGTGAGCCAGGGATGGGAGAAGG + Intergenic
919540469 1:198839245-198839267 AGTGTGACAGGCCTGTGAGAAGG + Intergenic
920825981 1:209424624-209424646 TGTGTGCAAGGTCTGGGAGTAGG + Intergenic
922236592 1:223726897-223726919 AGCGTGCTAGGCCTGCGAGAGGG - Intronic
922779693 1:228241505-228241527 GCTCTGCTAGGGCTGGCAGATGG - Intronic
1064969436 10:21049309-21049331 GGTGTGGTGGGCCTGCTAGATGG - Intronic
1067803562 10:49377161-49377183 GTTGCTCTGGGCCTGGGAGAAGG - Intronic
1069922886 10:71827964-71827986 GATGTTCTGGGCCTGGGAGTTGG - Intronic
1071242702 10:83725787-83725809 GGTGGGCTAGGACAGGGAGTTGG + Intergenic
1073456004 10:103637150-103637172 CGTGTGCCATGCCTGGGTGATGG - Intronic
1074448691 10:113541272-113541294 GGTGAGCCAGGCCTGAGAGCTGG + Intergenic
1075360687 10:121830221-121830243 GGTGTGGTAGTGTTGGGAGATGG + Intronic
1075511092 10:123073582-123073604 GGTTTTCCAGGACTGGGAGAAGG - Intergenic
1076267241 10:129118417-129118439 GGTGGGAAGGGCCTGGGAGAAGG + Intergenic
1076903458 10:133351072-133351094 GGAGTGCTAGGTCAGGGATACGG + Intronic
1077012347 11:384917-384939 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012361 11:384955-384977 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012375 11:384993-385015 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012389 11:385031-385053 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012403 11:385069-385091 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012417 11:385107-385129 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012431 11:385145-385167 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012445 11:385183-385205 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012459 11:385221-385243 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012473 11:385259-385281 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012487 11:385297-385319 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012501 11:385335-385357 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012515 11:385373-385395 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012529 11:385411-385433 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012543 11:385449-385471 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012557 11:385487-385509 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012571 11:385525-385547 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012585 11:385563-385585 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012599 11:385601-385623 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012613 11:385639-385661 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077012627 11:385677-385699 GGGGTTCCAGGCCTGGGAGTGGG - Intergenic
1077020593 11:415599-415621 GGGGAGCTATGTCTGGGAGAGGG - Intronic
1077471361 11:2762165-2762187 CGTGTGTCAGGCCTGGGAGGGGG + Intronic
1078432522 11:11298711-11298733 GCTGTGATGGGGCTGGGAGAGGG - Intronic
1078557997 11:12346308-12346330 TGTGTGCCAGGACTGGGATAAGG + Intronic
1081588936 11:44407543-44407565 GCGGGGCTAGGACTGGGAGATGG - Intergenic
1084168653 11:67389682-67389704 GGTGGCCTAGGCCTTGGAGATGG + Intronic
1084598795 11:70132838-70132860 GTGGGGCCAGGCCTGGGAGATGG - Intronic
1084789768 11:71466423-71466445 GATGTGCTGGGCCTGGGAGGTGG + Intronic
1089297868 11:117480774-117480796 CTTGTTCTTGGCCTGGGAGAGGG + Intronic
1089563457 11:119357421-119357443 GGTGTGCAAGGCCGGAGGGAGGG - Intronic
1090400365 11:126444940-126444962 GGTGAGCCAGGCCTGAGGGAGGG - Intronic
1090805351 11:130198824-130198846 GGTGGGGCAGGCCTGGGTGAGGG + Intronic
1091280309 11:134378017-134378039 GATGTGGTGGGCGTGGGAGAAGG - Intronic
1091543209 12:1481711-1481733 CGTATGCTATGCCTGGGAAAAGG - Intronic
1095404183 12:41849494-41849516 GGTGGGAAAGGACTGGGAGAAGG - Intergenic
1096183910 12:49566103-49566125 GGTGCCCAAGGCCTGGGAGGAGG + Exonic
1096536218 12:52276798-52276820 GGTGTGAGAGGGCTGGGAGGTGG - Intronic
1097186118 12:57197415-57197437 GCTGTGCTGGGTCTGGGAGATGG - Intronic
1097363906 12:58689996-58690018 GGTGTGCTAGACCTGGAGGGTGG + Intronic
1100361664 12:93885034-93885056 GGTGGGAATGGCCTGGGAGAAGG + Intronic
1101572921 12:105971513-105971535 GGTTTGGAAGGCCTGGGAAATGG + Intergenic
1101744524 12:107528684-107528706 GGAGGGCTAGCCATGGGAGATGG - Intronic
1102041632 12:109804769-109804791 GGTGTCTTAGGCATGTGAGAGGG - Intronic
1102394175 12:112573979-112574001 GGTGTGGTGGGGCAGGGAGAGGG + Intronic
1102477716 12:113199662-113199684 TGTGTGCTAGGCCTGGGTCTTGG + Intronic
1103552790 12:121748478-121748500 GCTGTGCTAGGCCTGGGCATGGG - Intronic
1103567791 12:121825514-121825536 GGTGGGCGGGGCCTAGGAGAAGG + Intronic
1103838746 12:123845651-123845673 GGTGTGGTGGACCTGGGAGGTGG + Exonic
1104908311 12:132227351-132227373 GGGGAGCTGGGCCGGGGAGAGGG - Intronic
1105016030 12:132787409-132787431 GGGGTCCTAGGCCTTGGGGAGGG - Intronic
1105448923 13:20481414-20481436 GGTGGGCAAGGCCTGGGGAACGG + Intronic
1107011995 13:35678909-35678931 TGTGTGGTTGGCCTGGGACAGGG - Intergenic
1107459247 13:40585469-40585491 GGTGTGATCTGGCTGGGAGAAGG - Intronic
1109195966 13:59377650-59377672 GGTGTTCTATTCCAGGGAGATGG - Intergenic
1113475001 13:110574313-110574335 AGTGTGCTGGGGCTGGTAGATGG - Intergenic
1113793572 13:113043482-113043504 GATGTGCCAGGCCACGGAGATGG - Intronic
1116143629 14:41034463-41034485 CTTGTGCTAGGCATGGGAGATGG - Intergenic
1117438726 14:55741362-55741384 GGGGTGGGAGGCCTGGGGGAAGG + Intergenic
1117726762 14:58682383-58682405 ATTGTGCTAGGGCAGGGAGAAGG + Intergenic
1117788935 14:59317889-59317911 GGCTTGCTAGGCCTGGGGGTGGG - Intronic
1117984108 14:61370409-61370431 AGTTTGCTAGGCCTGGGGGTGGG + Intronic
1119105508 14:71919604-71919626 TGTGTGCTGGGGGTGGGAGAAGG + Intergenic
1121312771 14:92944154-92944176 GGTGGGAGAGGCCTGGGAGAGGG - Intronic
1122286390 14:100655088-100655110 GGTGGGGTTGGGCTGGGAGAGGG + Intergenic
1202917948 14_KI270723v1_random:2740-2762 TGGGGGCTAGGCCTTGGAGAAGG + Intergenic
1125310308 15:38372024-38372046 GGTGTGCTGGGGCTGGGGTAGGG - Intergenic
1125660960 15:41394319-41394341 GGTGTCCTAGGCCTGCGTGGTGG - Intronic
1126300023 15:47184690-47184712 GCTGTGCCAGGCCGGGGGGAGGG + Intronic
1129228914 15:74185610-74185632 TGTGTGCATGGCCAGGGAGAGGG - Intronic
1129591852 15:76922368-76922390 AGTAGGCTAGGGCTGGGAGAGGG - Intergenic
1130228148 15:82075727-82075749 GGTGTGCTGGCCCCTGGAGAAGG + Intergenic
1130243858 15:82224744-82224766 GGTGTGATAGGTGTAGGAGAGGG - Intronic
1131291481 15:91110668-91110690 AAAGTGCTGGGCCTGGGAGATGG + Intronic
1132142595 15:99407781-99407803 GGTGTGCTGGGCCTGCGGCATGG + Intergenic
1134008515 16:10834318-10834340 GGTGTGCCAGGCAAGGGAGACGG - Intergenic
1134232111 16:12437450-12437472 CCTGTGCCAGGCATGGGAGATGG + Intronic
1134454279 16:14382822-14382844 GGTTTTCAGGGCCTGGGAGAAGG - Intergenic
1134557913 16:15182160-15182182 GGCCTGCTAGGGCTGGGTGAGGG - Intergenic
1134918449 16:18093763-18093785 GGCCTGCTAGGGCTGGGTGAGGG - Intergenic
1135933408 16:26758866-26758888 GCTGTGCCAGGCATTGGAGATGG + Intergenic
1139007434 16:62590304-62590326 GGTGGGCTAGGTATGGAAGAAGG + Intergenic
1139419656 16:66842653-66842675 GGGGTTCAGGGCCTGGGAGAGGG + Intronic
1141212752 16:81996377-81996399 GGTGTGTCAAGTCTGGGAGAGGG + Exonic
1141735763 16:85851552-85851574 TGTGTGCAAGGCCCGGGAGAGGG - Intergenic
1141824304 16:86468309-86468331 GGTGTCCTAGACCTGGTGGACGG - Intergenic
1143139475 17:4733178-4733200 GGAGAACTAGGCCAGGGAGATGG + Exonic
1143518076 17:7429929-7429951 GGTGTCCTGGGCCTGGGAGTGGG - Intergenic
1143542902 17:7580193-7580215 GTTGGGCTAGGACTCGGAGAGGG - Exonic
1145055993 17:19704340-19704362 GGAGGGCTGGGGCTGGGAGAAGG + Intronic
1145957934 17:28867767-28867789 CGGGTGCTGGGCCAGGGAGATGG - Intergenic
1145965333 17:28912839-28912861 GGTGTGAGAGGCCTGGTAGTGGG + Exonic
1146382645 17:32342219-32342241 GGTGTGCGAGGGCCGGGAGCCGG - Intronic
1147266687 17:39238547-39238569 GGTATGCTAGGCCTGGGAGAGGG + Intergenic
1149444338 17:56701967-56701989 GGGGTGATATCCCTGGGAGAAGG - Intergenic
1149856714 17:60088964-60088986 GAGGTGCTAGGCCTGGAAGTTGG - Intergenic
1150212007 17:63446651-63446673 GGTCGGCCAGGCCTGGGGGATGG + Intergenic
1150213191 17:63452746-63452768 AGTGTGCAAGGCCTGGGGTAAGG + Intergenic
1151063872 17:71128622-71128644 GGTGTGTTACTCCTGGGAGGAGG + Intergenic
1151492978 17:74443617-74443639 GGGGTGCTAGGCTTGGGAGGGGG + Intronic
1151825784 17:76523475-76523497 GGTGGGCTATGCCTGGGTGCAGG - Intergenic
1153972780 18:10241565-10241587 GGTGTGCTCTGCCAGGGAGCCGG - Intergenic
1156471840 18:37381956-37381978 TGTGCTCTAGGCCTGGGAGGAGG + Intronic
1156485181 18:37461086-37461108 GGTATGAGAGGCTTGGGAGAAGG + Intronic
1157313078 18:46566665-46566687 GGTGTGCTGGGCTTAGGAGAAGG - Intronic
1157652680 18:49350762-49350784 GGTATGCTATGAATGGGAGAGGG + Intronic
1157732994 18:50020823-50020845 AAAGTGCTAGGCCAGGGAGATGG + Intronic
1157767102 18:50307596-50307618 GGTGGGCTAGGCCTGGGGGCGGG + Intergenic
1159376355 18:67598422-67598444 AGTGTGATAGTACTGGGAGATGG - Intergenic
1159955014 18:74512982-74513004 GCTGTGCTTGGCCTGAGAGCAGG - Intronic
1160190126 18:76708638-76708660 GGGGTGCTAGGCCAGGAAAAGGG - Intergenic
1160876957 19:1300828-1300850 GGTCTTCTCGGCCTCGGAGAGGG - Intergenic
1162803275 19:13122773-13122795 AATGTGCGAGGTCTGGGAGATGG + Intronic
1163432495 19:17276624-17276646 GGTGGGTGAGGCCTGGGAGAGGG + Exonic
1163514983 19:17757335-17757357 GGTTTGCCAGGTCTGGGAAACGG + Intronic
1163552117 19:17971285-17971307 CATGTGCCAGGCCTGGGAGAAGG - Intronic
1163572366 19:18090007-18090029 GATGTGTGAGGCCTGGGGGAGGG + Intronic
1163718763 19:18887917-18887939 GGGGTGCCAGGGCTGGGGGAGGG - Intronic
1164399743 19:27894421-27894443 GCTGGGCTAGGCCTGGGGGTTGG - Intergenic
1164601540 19:29566538-29566560 GGTGTGATAGGCATAGGGGAGGG + Intergenic
1165087714 19:33362802-33362824 GGTGTGCTAGCCAAGGGTGAGGG + Intergenic
1165155175 19:33782481-33782503 CTTGTGCTAGACCTGGGTGATGG + Intergenic
1165863483 19:38921682-38921704 GGTGGGCTCAGCCCGGGAGAGGG + Intronic
1166178060 19:41088651-41088673 GGTGTCCTAAGGCAGGGAGATGG + Exonic
1166788853 19:45385723-45385745 GGTGTCCTAGGCGTGGGGGTGGG + Exonic
1166861051 19:45811403-45811425 GGGGTGCCAGGGATGGGAGAAGG + Intronic
1167337404 19:48895492-48895514 GGTTCCCAAGGCCTGGGAGAAGG + Exonic
1167490769 19:49791824-49791846 GGTGTGCGAGGCCAGCGAGAGGG - Intronic
1168413344 19:56153717-56153739 AGTGGGGTAGGCCTGGGAGGTGG + Intronic
1168525913 19:57088639-57088661 GGTGGGCTGGACCCGGGAGAAGG + Intergenic
1168645896 19:58059310-58059332 GGTGAGCTAGGCCGGCGAGGAGG + Exonic
925718820 2:6808971-6808993 GCTGTGCTTGGCTGGGGAGAAGG + Intergenic
925817668 2:7769104-7769126 GGTGGACTGTGCCTGGGAGATGG - Intergenic
925962776 2:9033963-9033985 GGTGGGGTAGGCCTGGGAGTAGG - Intergenic
926766884 2:16329973-16329995 GGTGTTCGAGGCCTGGGTGCAGG - Intergenic
928689258 2:33782277-33782299 GGGGTGCTGGGGCAGGGAGAGGG - Intergenic
931801697 2:65765226-65765248 GAATTGCTAGCCCTGGGAGAGGG - Intergenic
932098501 2:68874144-68874166 GGTGTCCCAGGCCTGGAAGAGGG - Intergenic
932475635 2:72004046-72004068 GGTGCCCCAGGCCAGGGAGAGGG + Intergenic
932691554 2:73917850-73917872 GCTGTGCCAGGCCTGGGGCAGGG + Intronic
933223445 2:79717475-79717497 GGTATGCTAGGCCAGGGAGGAGG + Intronic
933770829 2:85742874-85742896 GGTGGGCTGGGGCGGGGAGAGGG + Intergenic
933814212 2:86052740-86052762 TCTGTCCTGGGCCTGGGAGATGG + Intronic
933877783 2:86636175-86636197 GGCCTGCTAGGGGTGGGAGAGGG + Intronic
936093127 2:109513652-109513674 GGTGTCCTAGAACTGGGAGAAGG - Intergenic
937085544 2:119169364-119169386 GGTGTGTGAGGCCTGGGTTAAGG - Intergenic
937281827 2:120722587-120722609 GAAGTGCGAAGCCTGGGAGAGGG - Intergenic
938302659 2:130228193-130228215 GGAGGGCTAGGCCTGGGGGCGGG - Intergenic
938409046 2:131048749-131048771 AGTGTGGTTGGCCTGGGGGAAGG - Exonic
938421560 2:131151351-131151373 GGTGTGCCATGCCTGGGGGAAGG + Intronic
938454009 2:131446029-131446051 GGAGGGCTAGGCCTGGGGGCGGG + Intergenic
938455569 2:131460706-131460728 GGTTGGCCAGGCCGGGGAGAGGG + Intergenic
938761958 2:134434105-134434127 GGTTTGCTGGGCCAGGGAAAGGG - Intronic
939627869 2:144500735-144500757 TCTGTACTAGGCCTGGGAGCTGG + Intronic
940557082 2:155243015-155243037 GGAGTGATAGGCTTTGGAGATGG - Intergenic
941905469 2:170714280-170714302 GGTCTGCCAGGCTTGCGAGAGGG + Exonic
944422585 2:199546921-199546943 AGTGTGGTAGCCCTGGGAGGGGG - Intergenic
948304956 2:236939963-236939985 GCTGAGCTAGGCCTGGCAAACGG + Intergenic
948375786 2:237519569-237519591 GCTGTTCCAGGGCTGGGAGAGGG - Intronic
1168737938 20:160106-160128 GGTGTTCTAGGGCTGGTATAGGG + Intergenic
1168869736 20:1118362-1118384 GGTATGCTAGGCCGGGGAAGGGG - Intronic
1171216387 20:23355644-23355666 AGTGTGCTAGGTTTGGGATAGGG + Intergenic
1171501951 20:25600633-25600655 GGTCTGCAAGGCAAGGGAGAGGG - Intergenic
1172294490 20:33798886-33798908 AGTGTGGTGGGCCTGGGAGCAGG - Intergenic
1172390046 20:34559909-34559931 GGGGGGCTCGGCCTGGGAGTCGG + Exonic
1172448157 20:35003751-35003773 GGTGAGATAGGACTGGGGGAAGG + Intronic
1173531762 20:43775095-43775117 TGTGTGCTAGGGCTGGGGGAAGG + Intergenic
1175073903 20:56358055-56358077 GGTGGCCTAGGGCTGGGAGTGGG - Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175809586 20:61850785-61850807 GGTGTGCCCAGCCTGAGAGATGG + Intronic
1175880346 20:62254428-62254450 GGTGTGCTTGCCCTTGCAGACGG - Intronic
1176303811 21:5113259-5113281 GGTGGGAGGGGCCTGGGAGAGGG + Intergenic
1179853219 21:44148691-44148713 GGTGGGAGGGGCCTGGGAGAGGG - Intergenic
1179888610 21:44325063-44325085 GCTGGGCCAGGCCTGGGAGAGGG - Intronic
1180071664 21:45439888-45439910 TGGGAACTAGGCCTGGGAGATGG + Intronic
1180099168 21:45576358-45576380 GGTGTGAGGGGCCAGGGAGATGG - Intergenic
1180831793 22:18910451-18910473 GGTGTGCTGGGACTGGGTGGAGG + Intronic
1180997797 22:19974068-19974090 GGTGGGCAAGTCCTGAGAGAGGG - Intronic
1181278176 22:21699938-21699960 GGTGAGCTAGCCCTTAGAGAAGG - Exonic
1181512114 22:23393767-23393789 GTTGTCCCACGCCTGGGAGAAGG - Intergenic
1182486250 22:30640835-30640857 TGTGACCCAGGCCTGGGAGAAGG + Intronic
1182822096 22:33225244-33225266 GCTGTTCTGGGCCTGGGAGCAGG + Intronic
1183444961 22:37847449-37847471 ACTGTGCCAGGCCTCGGAGAAGG + Intronic
1183661472 22:39224041-39224063 GGTGTGGGACACCTGGGAGAAGG - Exonic
1184556482 22:45235972-45235994 TGTGTGCTAGGCCTGCGAATGGG - Intronic
1184756735 22:46520356-46520378 GGTGTGGGAGGCGTGGGAGCAGG - Intronic
1185318075 22:50187302-50187324 GGTGTGGCAGAGCTGGGAGACGG - Intronic
1203281873 22_KI270734v1_random:135722-135744 GGTGTGCTGGGACTGGGTGGAGG + Intergenic
950476471 3:13218217-13218239 GGTGTGCGAGGCCTGGGGCAAGG + Intergenic
950527677 3:13533921-13533943 GGTGTGTTAGGCCTGGCACAGGG + Intergenic
951301720 3:21006580-21006602 GGTTTCCTAGTGCTGGGAGAGGG - Intergenic
951432118 3:22620534-22620556 GGTGTGCTGGGCCTGTGAGGAGG + Intergenic
952702083 3:36338515-36338537 GGTGAGACAGGCCTGTGAGATGG + Intergenic
954283961 3:49604773-49604795 GGTGTGGGAGGCCTGGGAAATGG - Intronic
954524986 3:51261937-51261959 GGTGTTCTATCCCAGGGAGATGG - Intronic
956016812 3:64892644-64892666 TGGGGGCTGGGCCTGGGAGAGGG - Intergenic
956301862 3:67781214-67781236 GGTGTTCTATCCCAGGGAGATGG + Intergenic
961485474 3:127212876-127212898 GCTGTGCAAGGCCTGGCAGGTGG - Intergenic
961613890 3:128163708-128163730 GGTTGCCTAGGCCTGGGAGAGGG - Intronic
961616563 3:128187354-128187376 AGTGTGCTAGACCAGAGAGAAGG + Intronic
961825127 3:129595317-129595339 TGTGTGCCAGCCCTGGGAGGGGG + Intronic
963763531 3:149309313-149309335 GGTTTGCTTGGGCTGGGAGCTGG - Intergenic
964394207 3:156228571-156228593 GGTGTGCTAGAGCTTGGAGGTGG + Intronic
968258386 3:197298673-197298695 GGAGGGCGGGGCCTGGGAGAGGG + Intronic
968284864 3:197502569-197502591 CTGGGGCTAGGCCTGGGAGAGGG - Intergenic
968981307 4:3851160-3851182 GGTGGCCTTGGCCTAGGAGAGGG - Intergenic
969064911 4:4471100-4471122 GGTGTCAAAAGCCTGGGAGAAGG + Intronic
969423615 4:7111196-7111218 GGTGAGGGAGACCTGGGAGAAGG + Intergenic
969656653 4:8502681-8502703 TGTGAGCTGGCCCTGGGAGAGGG - Intergenic
970030414 4:11667675-11667697 AGTGGGCTAAGCCTGGGAGGAGG - Intergenic
973938603 4:55879312-55879334 GGAATGCCAGGACTGGGAGAAGG + Intronic
975721406 4:77252006-77252028 GGTGTGCTTGGCAAGTGAGATGG + Intronic
977664197 4:99626115-99626137 GATTTCCTAGGGCTGGGAGATGG - Intergenic
978862882 4:113471707-113471729 GGTGTGGGAGACCTGGGAGCAGG - Intronic
981789594 4:148521524-148521546 GGTGCTCTGTGCCTGGGAGATGG + Intergenic
981954174 4:150449313-150449335 GGTCTGCTACTACTGGGAGAAGG + Intronic
984356300 4:178663724-178663746 GGTGTGCTAGGTCAAGCAGACGG + Intergenic
984710068 4:182877451-182877473 TGGGTGCGGGGCCTGGGAGAGGG - Intergenic
985168119 4:187119033-187119055 TGTGTGCAAGGCATGTGAGATGG + Intergenic
987051307 5:14148794-14148816 GGTGTGGTTGGCCTGGTGGATGG + Intronic
987317585 5:16738291-16738313 AGTGTCCCAGGCCTGGGAGCAGG + Intronic
987467580 5:18290738-18290760 GGAGTGCTAGGTATGTGAGAGGG - Intergenic
990598915 5:57337621-57337643 GGAGCGCTAGGTCTGGGACAAGG + Intergenic
990825199 5:59892098-59892120 GGCGTGGAAGGCCTGGGACAGGG + Intronic
992467355 5:77019922-77019944 TGTGTGCTAGGCCTGGTGCAAGG - Intergenic
996311526 5:122111692-122111714 TGTGTGTTTGGCCTGGGAGCAGG - Intergenic
997418808 5:133750078-133750100 GGTGAGCTGGGGATGGGAGATGG + Intergenic
997594225 5:135095539-135095561 GGTTTCCTGGGCCAGGGAGATGG - Intronic
998381851 5:141731263-141731285 GCTGTGGGAGGCATGGGAGAGGG + Intergenic
998744140 5:145237682-145237704 GGTGTGAGAGTCCTGTGAGAGGG - Intergenic
998856655 5:146400705-146400727 AGTGTGCTGGGCATGGGAGATGG + Intergenic
999209016 5:149871547-149871569 AGTGTGCAGGGCCTGGTAGAAGG + Intronic
999715439 5:154356412-154356434 GGTGTGGCAGGGCTGGGGGAGGG + Intronic
1001412705 5:171522146-171522168 GGTTTTCTAGGCCAGGGAGGAGG - Intergenic
1001699657 5:173697610-173697632 GGTCTGCGAGGACAGGGAGATGG + Intergenic
1001708094 5:173756696-173756718 GGTGTTGAAGGCCTGGGACAGGG - Intergenic
1001962799 5:175890361-175890383 GCTCAGCTAGGCCTTGGAGAAGG - Intergenic
1002410956 5:179076108-179076130 GGAGTGCTAGGCTCGGAAGATGG - Intronic
1002436492 5:179234876-179234898 GGTCTGCTAGGCTTGGGAAGAGG - Intronic
1002985932 6:2190924-2190946 GATGTTCCAGGCCTGGGAGCGGG - Intronic
1003110608 6:3249480-3249502 GGTGTGCTGGGCAGGGGAAATGG - Intronic
1003201978 6:3969708-3969730 GGTCTGCTAGGCCTTGGCGGGGG + Intergenic
1004929125 6:20444855-20444877 GGTGTGGTAGGACTGGGATGTGG + Intronic
1006017908 6:31097175-31097197 GGTCTGCTAGCCCTTGGAAAGGG - Intergenic
1006300068 6:33189284-33189306 GGTGGGGTAGGCCTGGGGGGAGG - Intronic
1006836210 6:37000234-37000256 GGTGTCCAGGGCCTGGGAAATGG - Intergenic
1007125057 6:39418982-39419004 GCTGCCCTGGGCCTGGGAGATGG + Intronic
1007394616 6:41570431-41570453 GGAGTGCTGTGGCTGGGAGAGGG + Intronic
1007810059 6:44479344-44479366 GGTGGGAATGGCCTGGGAGAGGG - Intergenic
1007829529 6:44627764-44627786 GCTGTGCCAGCCCTGTGAGAAGG + Intergenic
1011182967 6:84642130-84642152 GGAGAACAAGGCCTGGGAGAGGG + Intergenic
1011785684 6:90841957-90841979 GGTGAGCTTGGCTTGGCAGAAGG - Intergenic
1016220940 6:141669045-141669067 GGTGTGCTTAGCCTAGGAGCTGG - Intergenic
1016510361 6:144835938-144835960 GGTGTGCTAGGCCTGGGAGAAGG + Exonic
1017027417 6:150193595-150193617 GGAGGGCCAGGGCTGGGAGAAGG + Intronic
1018143503 6:160862748-160862770 GGTGTTCTAGCCCTTGAAGAGGG - Intergenic
1018786790 6:167114493-167114515 GGTTTCCTATGCCTGGAAGAAGG - Intergenic
1018815632 6:167328496-167328518 GGTGTTCTAGCCCTTGAAGAGGG + Intronic
1019119574 6:169792455-169792477 GGTGTGCTGGGCCTGGGCCCTGG + Intergenic
1019173387 6:170147310-170147332 GGTGTGCTGGCCCTAGGAGCAGG + Intergenic
1019897320 7:3992415-3992437 AGTGTCCTAGGCCTGGGTCAAGG + Intronic
1020504207 7:8962892-8962914 GGTGTGTTAGGCTTGGAAAAAGG - Intergenic
1021292963 7:18868716-18868738 GGTGTGCTAGGCTTCAGAGGCGG + Intronic
1024553584 7:50584136-50584158 CTTGTGCCTGGCCTGGGAGATGG + Intergenic
1026792921 7:73346464-73346486 GCTGAGCTAGGCCTGGGGCATGG + Intronic
1028122527 7:87072232-87072254 GGTGTACTTTGCCTGGAAGAAGG - Intergenic
1028818247 7:95174990-95175012 GTTGTGAGAGGCCTGGCAGAGGG - Intronic
1029104323 7:98163118-98163140 GGTGGGCTGGGGCTGGGAAATGG + Intronic
1029492866 7:100881830-100881852 GGGTTGGTAGGCCTGGGGGATGG + Intronic
1033244300 7:139705266-139705288 TGTGTGCCAGGCATGGCAGAGGG + Intronic
1034345816 7:150384562-150384584 GGTGGGCTATGTCTGGGAAATGG - Intronic
1035312587 7:157979045-157979067 GGTGCAGTAGGCCTGGGGGAGGG - Intronic
1036619560 8:10415644-10415666 GGTGGGCTAGGCCAGGGTGAGGG - Intronic
1037536767 8:19832038-19832060 GATTTGCTTGGCCTGGAAGACGG + Exonic
1039452940 8:37690270-37690292 GGGGAGCTAGGCCGGGGAGATGG - Intergenic
1039791843 8:40882554-40882576 GGTGTGCCAGGCCAGGGGGCTGG - Intronic
1040915305 8:52562713-52562735 GGTACGTTAGGCCTGGGTGATGG + Intronic
1042657618 8:71117270-71117292 GCTGTGCTATGTGTGGGAGAAGG - Intergenic
1042804632 8:72757956-72757978 GGTGTGCATGGCATGGCAGAGGG + Intronic
1042936490 8:74064365-74064387 GGTGTTCTAGTCATGGGAGGCGG + Intergenic
1044925872 8:97208326-97208348 GGCCTGCTAGGCCTTGGAAATGG - Intergenic
1045171548 8:99676197-99676219 GGTGTGGCAGGCCTGGGTGTAGG - Intronic
1046890420 8:119416114-119416136 GGTGTCTTCGTCCTGGGAGAAGG + Intergenic
1047060725 8:121221852-121221874 AGTGTGCTAGGCTTAGGAGAGGG + Intergenic
1047203237 8:122783031-122783053 GCTGTGCTGAGCCTGGGAGGCGG + Intronic
1047310728 8:123689512-123689534 GGTCTGCAAGGGCTGGGAGCCGG + Intronic
1049777415 8:144413145-144413167 GGTGGGCGGGGCCTGGAAGATGG - Intronic
1053286940 9:36855745-36855767 GGTGTGGTTGGCCTGGAATATGG - Intronic
1055002511 9:71468315-71468337 TGTTTGCCAGGCCTGGGAGAGGG - Intergenic
1055182139 9:73401672-73401694 GTTGTGAAAGGCCTTGGAGAAGG - Intergenic
1056106150 9:83348741-83348763 TTTGTGCTGGGCGTGGGAGATGG - Intronic
1057192021 9:93093723-93093745 CGTGTGCTATGCCTGGGGGAGGG + Intergenic
1057314801 9:93961288-93961310 GGGGAGCTAGGCCTGGGATTGGG + Intergenic
1057434788 9:95029830-95029852 GTAGTGCTTGTCCTGGGAGATGG + Intronic
1057685929 9:97234543-97234565 CGTGTGCTAAGCAAGGGAGAAGG - Intergenic
1059658064 9:116374459-116374481 TGTGTGCTAGAACTGGGAAAGGG - Intronic
1061880936 9:133568527-133568549 GGGGAGCTGGGCTTGGGAGATGG + Intronic
1061941324 9:133885752-133885774 GGTTTGCGAGGTCAGGGAGATGG - Intronic
1062012291 9:134273646-134273668 TGTGTGCCAGGCCTGGGTGGAGG - Intergenic
1062174521 9:135153531-135153553 GGTGGGGCAGGCCTGGTAGATGG + Intergenic
1062520550 9:136955947-136955969 GATGCCCCAGGCCTGGGAGAGGG + Intronic
1062607455 9:137354540-137354562 GCTGGGCCAGGCCTGGGTGAAGG - Intronic
1190571190 X:51783622-51783644 GATCTGTTAAGCCTGGGAGATGG + Intergenic
1195781863 X:108475699-108475721 GGGGCTCTAGGCCTGGAAGAGGG - Intronic
1198422020 X:136477804-136477826 GGTTTACATGGCCTGGGAGAGGG + Intergenic
1199599649 X:149534363-149534385 GGTGTGCTGGGTCTGGGAAGGGG + Intergenic
1199650984 X:149945847-149945869 GGTGTGCTGGGTCTGGGAAGGGG - Intergenic
1200749590 Y:6932837-6932859 GGTGGCCTGGGGCTGGGAGATGG - Intronic