ID: 1016512533

View in Genome Browser
Species Human (GRCh38)
Location 6:144859701-144859723
Sequence CAGTATGTGCTTCTGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016512533 Original CRISPR CAGTATGTGCTTCTGGAACA GGG (reversed) Intergenic
No off target data available for this crispr