ID: 1016519575

View in Genome Browser
Species Human (GRCh38)
Location 6:144931464-144931486
Sequence AGGCAGGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016519571_1016519575 4 Left 1016519571 6:144931437-144931459 CCCACTTTCAGTTACATGTGAAT No data
Right 1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG No data
1016519572_1016519575 3 Left 1016519572 6:144931438-144931460 CCACTTTCAGTTACATGTGAATT No data
Right 1016519575 6:144931464-144931486 AGGCAGGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016519575 Original CRISPR AGGCAGGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr