ID: 1016520213

View in Genome Browser
Species Human (GRCh38)
Location 6:144938497-144938519
Sequence CTGGGTAGTATTGAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016520213_1016520218 23 Left 1016520213 6:144938497-144938519 CCTTTCTCCTCAATACTACCCAG No data
Right 1016520218 6:144938543-144938565 TTTCTTTTTCCTCAAATCTACGG No data
1016520213_1016520216 -5 Left 1016520213 6:144938497-144938519 CCTTTCTCCTCAATACTACCCAG No data
Right 1016520216 6:144938515-144938537 CCCAGCTCTTTTTATTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016520213 Original CRISPR CTGGGTAGTATTGAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr