ID: 1016521458

View in Genome Browser
Species Human (GRCh38)
Location 6:144951341-144951363
Sequence CTGTGGATACTGAGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016521458_1016521466 26 Left 1016521458 6:144951341-144951363 CCATCATCCCTCAGTATCCACAG No data
Right 1016521466 6:144951390-144951412 CTCAATTTCCTGATATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016521458 Original CRISPR CTGTGGATACTGAGGGATGA TGG (reversed) Intergenic
No off target data available for this crispr