ID: 1016529649

View in Genome Browser
Species Human (GRCh38)
Location 6:145043463-145043485
Sequence GTCTTCAGGGATTCACAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016529649_1016529653 -4 Left 1016529649 6:145043463-145043485 CCCTACTGTGAATCCCTGAAGAC No data
Right 1016529653 6:145043482-145043504 AGACTGTTTTTTTTTCAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016529649 Original CRISPR GTCTTCAGGGATTCACAGTA GGG (reversed) Intergenic
No off target data available for this crispr