ID: 1016542039

View in Genome Browser
Species Human (GRCh38)
Location 6:145177540-145177562
Sequence TTATGGATATAGAGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016542035_1016542039 26 Left 1016542035 6:145177491-145177513 CCACATATTCTCACTTATTTATG No data
Right 1016542039 6:145177540-145177562 TTATGGATATAGAGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016542039 Original CRISPR TTATGGATATAGAGAGCAGA AGG Intergenic
No off target data available for this crispr