ID: 1016543620

View in Genome Browser
Species Human (GRCh38)
Location 6:145195466-145195488
Sequence TTGGAGGAAGGGCCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016543620_1016543630 6 Left 1016543620 6:145195466-145195488 CCTCCCTCAGGCCCTTCCTCCAA No data
Right 1016543630 6:145195495-145195517 GGATTATTAGACATGAGATTTGG No data
1016543620_1016543632 10 Left 1016543620 6:145195466-145195488 CCTCCCTCAGGCCCTTCCTCCAA No data
Right 1016543632 6:145195499-145195521 TATTAGACATGAGATTTGGGTGG No data
1016543620_1016543633 11 Left 1016543620 6:145195466-145195488 CCTCCCTCAGGCCCTTCCTCCAA No data
Right 1016543633 6:145195500-145195522 ATTAGACATGAGATTTGGGTGGG 0: 25
1: 704
2: 3607
3: 13240
4: 14096
1016543620_1016543631 7 Left 1016543620 6:145195466-145195488 CCTCCCTCAGGCCCTTCCTCCAA No data
Right 1016543631 6:145195496-145195518 GATTATTAGACATGAGATTTGGG No data
1016543620_1016543634 12 Left 1016543620 6:145195466-145195488 CCTCCCTCAGGCCCTTCCTCCAA No data
Right 1016543634 6:145195501-145195523 TTAGACATGAGATTTGGGTGGGG 0: 23
1: 685
2: 3408
3: 13003
4: 15006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016543620 Original CRISPR TTGGAGGAAGGGCCTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr