ID: 1016553002

View in Genome Browser
Species Human (GRCh38)
Location 6:145302817-145302839
Sequence TAGGGGCAATTCCAGTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016552992_1016553002 28 Left 1016552992 6:145302766-145302788 CCCAAATACATCAGTAATTGTAT No data
Right 1016553002 6:145302817-145302839 TAGGGGCAATTCCAGTGGTTGGG No data
1016552993_1016553002 27 Left 1016552993 6:145302767-145302789 CCAAATACATCAGTAATTGTATT No data
Right 1016553002 6:145302817-145302839 TAGGGGCAATTCCAGTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016553002 Original CRISPR TAGGGGCAATTCCAGTGGTT GGG Intergenic
No off target data available for this crispr