ID: 1016555322

View in Genome Browser
Species Human (GRCh38)
Location 6:145329820-145329842
Sequence CTCTTTTTGTACTCTGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016555322_1016555326 19 Left 1016555322 6:145329820-145329842 CCTGAATCAGAGTACAAAAAGAG No data
Right 1016555326 6:145329862-145329884 AGGTTCATATTGAAGAATGATGG No data
1016555322_1016555327 23 Left 1016555322 6:145329820-145329842 CCTGAATCAGAGTACAAAAAGAG No data
Right 1016555327 6:145329866-145329888 TCATATTGAAGAATGATGGCAGG No data
1016555322_1016555324 -4 Left 1016555322 6:145329820-145329842 CCTGAATCAGAGTACAAAAAGAG No data
Right 1016555324 6:145329839-145329861 AGAGAGTGGATTGATCTGAGTGG No data
1016555322_1016555325 -1 Left 1016555322 6:145329820-145329842 CCTGAATCAGAGTACAAAAAGAG No data
Right 1016555325 6:145329842-145329864 GAGTGGATTGATCTGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016555322 Original CRISPR CTCTTTTTGTACTCTGATTC AGG (reversed) Intergenic
No off target data available for this crispr