ID: 1016556973

View in Genome Browser
Species Human (GRCh38)
Location 6:145349760-145349782
Sequence CAATCAATAGCCTATAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016556973_1016556976 4 Left 1016556973 6:145349760-145349782 CCTGTTTTATAGGCTATTGATTG No data
Right 1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG No data
1016556973_1016556974 0 Left 1016556973 6:145349760-145349782 CCTGTTTTATAGGCTATTGATTG No data
Right 1016556974 6:145349783-145349805 ATGCCTGTCTGAAGAGAAGCAGG No data
1016556973_1016556977 20 Left 1016556973 6:145349760-145349782 CCTGTTTTATAGGCTATTGATTG No data
Right 1016556977 6:145349803-145349825 AGGATGGCTGTGAAAAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016556973 Original CRISPR CAATCAATAGCCTATAAAAC AGG (reversed) Intergenic
No off target data available for this crispr