ID: 1016559909

View in Genome Browser
Species Human (GRCh38)
Location 6:145384410-145384432
Sequence GTGGGGGCATGGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016559899_1016559909 27 Left 1016559899 6:145384360-145384382 CCTCTGAGACACAGGGTTATTTT No data
Right 1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016559909 Original CRISPR GTGGGGGCATGGAAGGAAGA AGG Intergenic
No off target data available for this crispr