ID: 1016560575

View in Genome Browser
Species Human (GRCh38)
Location 6:145391781-145391803
Sequence TTACTCTTCCCCAGTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016560575_1016560576 1 Left 1016560575 6:145391781-145391803 CCAGCTGCACTGGGGAAGAGTAA No data
Right 1016560576 6:145391805-145391827 TCCCAAGATCTCCCACTTTTAGG No data
1016560575_1016560581 14 Left 1016560575 6:145391781-145391803 CCAGCTGCACTGGGGAAGAGTAA No data
Right 1016560581 6:145391818-145391840 CACTTTTAGGCTGAAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016560575 Original CRISPR TTACTCTTCCCCAGTGCAGC TGG (reversed) Intergenic
No off target data available for this crispr