ID: 1016560654

View in Genome Browser
Species Human (GRCh38)
Location 6:145392281-145392303
Sequence GTCTCCGATGGCCTCCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016560651_1016560654 24 Left 1016560651 6:145392234-145392256 CCTTTTGTAATTAATTGGTATTA No data
Right 1016560654 6:145392281-145392303 GTCTCCGATGGCCTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016560654 Original CRISPR GTCTCCGATGGCCTCCTCAA AGG Intergenic
No off target data available for this crispr