ID: 1016562112

View in Genome Browser
Species Human (GRCh38)
Location 6:145408283-145408305
Sequence CTGGGTAGTACAGCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016562112_1016562119 20 Left 1016562112 6:145408283-145408305 CCAGTAACAGCTGTACTACCCAG No data
Right 1016562119 6:145408326-145408348 GATTTGCATTCAGCCATTATGGG No data
1016562112_1016562120 30 Left 1016562112 6:145408283-145408305 CCAGTAACAGCTGTACTACCCAG No data
Right 1016562120 6:145408336-145408358 CAGCCATTATGGGCCATGTGTGG No data
1016562112_1016562118 19 Left 1016562112 6:145408283-145408305 CCAGTAACAGCTGTACTACCCAG No data
Right 1016562118 6:145408325-145408347 TGATTTGCATTCAGCCATTATGG No data
1016562112_1016562113 -7 Left 1016562112 6:145408283-145408305 CCAGTAACAGCTGTACTACCCAG No data
Right 1016562113 6:145408299-145408321 TACCCAGCACCCTTTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016562112 Original CRISPR CTGGGTAGTACAGCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr