ID: 1016562113

View in Genome Browser
Species Human (GRCh38)
Location 6:145408299-145408321
Sequence TACCCAGCACCCTTTCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016562111_1016562113 5 Left 1016562111 6:145408271-145408293 CCAGGAGGATGACCAGTAACAGC No data
Right 1016562113 6:145408299-145408321 TACCCAGCACCCTTTCTCTTTGG No data
1016562110_1016562113 6 Left 1016562110 6:145408270-145408292 CCCAGGAGGATGACCAGTAACAG No data
Right 1016562113 6:145408299-145408321 TACCCAGCACCCTTTCTCTTTGG No data
1016562109_1016562113 18 Left 1016562109 6:145408258-145408280 CCTGCTCTGTGTCCCAGGAGGAT No data
Right 1016562113 6:145408299-145408321 TACCCAGCACCCTTTCTCTTTGG No data
1016562112_1016562113 -7 Left 1016562112 6:145408283-145408305 CCAGTAACAGCTGTACTACCCAG No data
Right 1016562113 6:145408299-145408321 TACCCAGCACCCTTTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016562113 Original CRISPR TACCCAGCACCCTTTCTCTT TGG Intergenic
No off target data available for this crispr