ID: 1016562118

View in Genome Browser
Species Human (GRCh38)
Location 6:145408325-145408347
Sequence TGATTTGCATTCAGCCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016562117_1016562118 -7 Left 1016562117 6:145408309-145408331 CCTTTCTCTTTGGCTTTGATTTG No data
Right 1016562118 6:145408325-145408347 TGATTTGCATTCAGCCATTATGG No data
1016562116_1016562118 -6 Left 1016562116 6:145408308-145408330 CCCTTTCTCTTTGGCTTTGATTT No data
Right 1016562118 6:145408325-145408347 TGATTTGCATTCAGCCATTATGG No data
1016562115_1016562118 0 Left 1016562115 6:145408302-145408324 CCAGCACCCTTTCTCTTTGGCTT No data
Right 1016562118 6:145408325-145408347 TGATTTGCATTCAGCCATTATGG No data
1016562112_1016562118 19 Left 1016562112 6:145408283-145408305 CCAGTAACAGCTGTACTACCCAG No data
Right 1016562118 6:145408325-145408347 TGATTTGCATTCAGCCATTATGG No data
1016562114_1016562118 1 Left 1016562114 6:145408301-145408323 CCCAGCACCCTTTCTCTTTGGCT No data
Right 1016562118 6:145408325-145408347 TGATTTGCATTCAGCCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016562118 Original CRISPR TGATTTGCATTCAGCCATTA TGG Intergenic
No off target data available for this crispr