ID: 1016568761

View in Genome Browser
Species Human (GRCh38)
Location 6:145489676-145489698
Sequence TCAGCTTCAGAATCCACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016568759_1016568761 -6 Left 1016568759 6:145489659-145489681 CCTCATTCTCTGCCTTTTCAGCT No data
Right 1016568761 6:145489676-145489698 TCAGCTTCAGAATCCACTGTTGG 0: 1
1: 1
2: 1
3: 22
4: 222
1016568758_1016568761 12 Left 1016568758 6:145489641-145489663 CCAGCATAGCTGTTCTGTCCTCA 0: 1
1: 0
2: 4
3: 15
4: 177
Right 1016568761 6:145489676-145489698 TCAGCTTCAGAATCCACTGTTGG 0: 1
1: 1
2: 1
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016568761 Original CRISPR TCAGCTTCAGAATCCACTGT TGG Intergenic