ID: 1016568791

View in Genome Browser
Species Human (GRCh38)
Location 6:145489987-145490009
Sequence CGTCCATCCAGATCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016568791 Original CRISPR CGTCCATCCAGATCTGCTCC AGG (reversed) Intergenic
902630358 1:17701174-17701196 CGTGCTTCCTGATCAGCTCCTGG - Intergenic
903580095 1:24364380-24364402 CGTCCTTCCACCTCTCCTCCAGG - Exonic
906211599 1:44015383-44015405 CGCCCATCCAGGGCAGCTCCAGG - Intronic
906319414 1:44807146-44807168 CTTCCACCCAGATCTACTCTAGG + Intergenic
911656557 1:100450490-100450512 CGTACTTCCATAACTGCTCCAGG - Intronic
921080099 1:211732297-211732319 GGCCCATCCAGAGCTCCTCCAGG - Intergenic
923002586 1:230019936-230019958 GGCCCATGCAGTTCTGCTCCTGG + Intergenic
1064974669 10:21101068-21101090 GGTCCATCCACTTCTGCTTCAGG - Intronic
1067558381 10:47287776-47287798 CTGCCATCCAGATATTCTCCAGG + Intergenic
1069403429 10:68074596-68074618 CGTGCACCCAGATCAGCTCATGG + Intronic
1070833913 10:79436269-79436291 TGTCCATCCAGAACCCCTCCAGG + Intronic
1071307775 10:84314313-84314335 CCTCCATTCAGATCTATTCCAGG - Intergenic
1073513242 10:104055815-104055837 CGAACATCCAGAGCTCCTCCTGG + Exonic
1074156370 10:110803869-110803891 CCTGCAGCCAGATCTACTCCTGG - Intronic
1077190336 11:1253386-1253408 CTTCCATCCTGAGCTTCTCCTGG - Intronic
1080749792 11:35141220-35141242 TTTCCATCCAGCACTGCTCCTGG - Intronic
1082310547 11:50641666-50641688 CTTCCTTCCAGATTTTCTCCTGG - Intergenic
1084162597 11:67357988-67358010 TTTCCATCCAGAGCTGCTTCAGG - Intronic
1084474987 11:69383805-69383827 CATCCATCAACCTCTGCTCCAGG - Intergenic
1086570741 11:88281459-88281481 GGTCCATCCAGGTCTGCTTCTGG + Intergenic
1089200571 11:116722483-116722505 CCTCCATCCAGGCCTCCTCCAGG + Intergenic
1089376439 11:117998613-117998635 CCTCCATCGAGCTCTCCTCCTGG + Intronic
1092602445 12:10081908-10081930 CCTACATCCATTTCTGCTCCAGG - Intronic
1096490335 12:52009487-52009509 CGTTCATCCAGATCTCCCCAGGG - Intronic
1096899386 12:54859241-54859263 TTTCAATCCAGATGTGCTCCTGG + Intergenic
1108277537 13:48826318-48826340 TGTCCAGGCAGATCTGCTGCAGG - Intergenic
1109032677 13:57213076-57213098 TGTTCAACCAGCTCTGCTCCAGG - Intergenic
1111950779 13:94707537-94707559 CGACCGTCCCTATCTGCTCCGGG + Intergenic
1117805981 14:59491157-59491179 CATCCTTCCAGATCAGCTCAGGG - Intronic
1121125824 14:91406191-91406213 GGTCCATCCAGCTCTGGGCCGGG - Intronic
1124615308 15:31237240-31237262 CGTCCATCCTGCTCTGCTCAGGG - Intergenic
1128758404 15:70198492-70198514 CATCTAACCAGAGCTGCTCCTGG - Intergenic
1130768041 15:86892978-86893000 CGTTCACACAGCTCTGCTCCTGG + Intronic
1132824822 16:1899067-1899089 GGTCCCTCCAGTTCTGATCCTGG - Intergenic
1132974024 16:2702680-2702702 CCTGCATGCAGAGCTGCTCCTGG + Intronic
1135516652 16:23141206-23141228 CCTCCATCCCGCTCTCCTCCTGG + Intronic
1136185812 16:28588308-28588330 CTTCCACCCAGTTCTGCTCTGGG + Intronic
1141308382 16:82888547-82888569 CCTCCATGCAGCACTGCTCCAGG + Intronic
1142249665 16:88985581-88985603 CGTCCCTCCAGATCCCCTCGGGG - Intergenic
1143203790 17:5129626-5129648 GGTCCATCTAGATGTCCTCCAGG + Intronic
1144874974 17:18392737-18392759 GGTCCATCTAGATGTTCTCCAGG + Intergenic
1145157250 17:20551684-20551706 GGTCCATCTAGATGTTCTCCAGG - Intergenic
1146844788 17:36175753-36175775 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1146857092 17:36263688-36263710 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1146863523 17:36324687-36324709 GGTCCATCCAGCTGTTCTCCAGG + Intronic
1146873004 17:36387598-36387620 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1146880362 17:36438684-36438706 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1147066383 17:37925275-37925297 GGTCCATCCAGCTGTTCTCCAGG + Intronic
1147075887 17:37988223-37988245 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1147077916 17:38004836-38004858 GGTCCATCCAGCTGTTCTCCAGG + Intronic
1147087412 17:38067769-38067791 GGTCCATCCAGCTGTTCTCCAGG - Intronic
1147093852 17:38128771-38128793 GGTCCATCCAGCTGTTCTCCAGG + Intergenic
1147103356 17:38191732-38191754 GGTCCATCCAGCTGTTCTCCAGG - Intergenic
1147576059 17:41599709-41599731 AGCCCAGGCAGATCTGCTCCTGG + Intergenic
1147978424 17:44260752-44260774 CCTCCATCCATCTCAGCTCCTGG + Exonic
1149847929 17:60018201-60018223 GGTCCATCCAGGTGTTCTCCAGG - Intergenic
1149994104 17:61397775-61397797 AGTCCATCCATAGCTGGTCCAGG - Intergenic
1150086284 17:62274818-62274840 AGTCCATCCAGGTGTTCTCCAGG - Intronic
1150131251 17:62670436-62670458 GGTCCAGCCACACCTGCTCCTGG - Intronic
1156313155 18:35943148-35943170 CTTCCACCCAGCTGTGCTCCTGG - Intergenic
1156701277 18:39828553-39828575 CTGCCTTCCAGATCTGCTTCCGG - Intergenic
1160328154 18:77969090-77969112 CATCCACCAAGACCTGCTCCTGG - Intergenic
1160411071 18:78675798-78675820 AGGCCATCCAGAGCTGGTCCTGG + Intergenic
1161261254 19:3338980-3339002 CCTCCATCCAGATGTGTCCCTGG + Intergenic
1163363885 19:16865496-16865518 CGTCCAGCCGGAACTTCTCCTGG - Exonic
1164456504 19:28411841-28411863 CCTCAACCCAGATGTGCTCCAGG + Intergenic
1166256021 19:41605175-41605197 CCTCCACCCAGGTCAGCTCCAGG + Intronic
1166966403 19:46531743-46531765 CTTCCAGACAGATCTGCTCCAGG - Intronic
928465790 2:31520946-31520968 CAAGCATCCAGATCTGCCCCAGG - Intergenic
931748934 2:65314079-65314101 CCGTCATCCAGATCTTCTCCCGG + Exonic
931789717 2:65654069-65654091 CTTCCATCCAGATCAGCAACAGG + Intergenic
931974600 2:67629492-67629514 AGTTCAGCCAGCTCTGCTCCAGG + Intergenic
932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG + Intergenic
936538933 2:113334501-113334523 CGACCATCCAGCTCTGGTTCAGG + Intergenic
945374495 2:209063641-209063663 CTTCCATGCAGACATGCTCCAGG + Intergenic
946307927 2:218866384-218866406 CCTCCATCCAGCCCTGCTCCTGG - Intronic
1172831848 20:37842623-37842645 CGTCCATCCAGGTCTGACCTGGG + Intronic
1179098297 21:38335087-38335109 CTTCCACCCAGACCTGCTGCAGG + Intergenic
1179809371 21:43860723-43860745 CGTCCAGCCCTACCTGCTCCAGG + Intergenic
1180085086 21:45504799-45504821 CGTGCATCCACCTCTGCTCCTGG + Intronic
1184781827 22:46653519-46653541 CATCCATCCACATCTGTCCCTGG + Intronic
949106293 3:203833-203855 CCTCCATCCTGCTCTGCTCTGGG - Intronic
951194922 3:19813347-19813369 CTTCCCTCCACATCTGATCCAGG - Intergenic
953165111 3:40457737-40457759 CGTCCATCCAGGTTGGCGCCTGG + Intronic
962816683 3:139006488-139006510 CGTGCATCCGGGTCTGCGCCAGG - Intronic
968068883 3:195773839-195773861 TGTCCCTCCAACTCTGCTCCAGG + Intronic
969468417 4:7371311-7371333 CGTCACTTCAGATGTGCTCCAGG - Intronic
973724768 4:53764295-53764317 AGTCCCTCCAGGTCTCCTCCGGG + Intronic
978776542 4:112511107-112511129 CGCCCATCCGGCTCTGGTCCAGG + Intergenic
979199696 4:117962225-117962247 CCTCCAGCCAGCTCTGCTCTTGG - Intergenic
982479347 4:155890653-155890675 CGTTCACCCAGATCTGTGCCTGG + Intronic
985881541 5:2642159-2642181 CCACCTTCCAGAACTGCTCCCGG - Intergenic
985965091 5:3333381-3333403 CATCCATCCAGGGCTGCTCCTGG + Intergenic
989597976 5:43174752-43174774 AGTCCATCCAGATCTGCTCCAGG + Exonic
992331063 5:75717688-75717710 CCTCTATCCAAATCAGCTCCCGG - Intergenic
997976934 5:138446240-138446262 CTTCCATCCACAGCTGCACCTGG - Exonic
1001022108 5:168191668-168191690 CATACATCCAGAGTTGCTCCTGG - Intronic
1005977985 6:30814922-30814944 CCCCCATCCAGCCCTGCTCCAGG + Intergenic
1007987696 6:46223745-46223767 CTTACAGCCAGAGCTGCTCCAGG + Intronic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1016568791 6:145489987-145490009 CGTCCATCCAGATCTGCTCCAGG - Intergenic
1016804065 6:148195420-148195442 TGTCCACCCAGAACTGCTCAAGG + Intergenic
1017323422 6:153119064-153119086 CATTCATGCAGATATGCTCCAGG + Intronic
1017368504 6:153674822-153674844 CGCCCATCCATATCTGGTGCTGG - Intergenic
1019668106 7:2262762-2262784 TGCCCATCCACATCTGTTCCTGG - Intronic
1020014144 7:4821154-4821176 GGTGCATTCAGAGCTGCTCCAGG - Intronic
1024057970 7:45677775-45677797 CCTCCAGCCAGATCCGCTGCAGG - Intronic
1024478497 7:49839561-49839583 CCTCCAGCCAGATCTTGTCCAGG - Intronic
1035627529 8:1082620-1082642 CCTCCATCCAGGGCTCCTCCTGG + Intergenic
1037435966 8:18863647-18863669 AGTCCATCCAGATTTATTCCAGG + Intronic
1040012514 8:42674239-42674261 CGTGCATCCACTTATGCTCCAGG - Intergenic
1040523559 8:48198518-48198540 CGCCCACCCAGCTCTGCCCCAGG + Intergenic
1042837439 8:73091307-73091329 CTTCCTTCCAGGTCAGCTCCTGG + Intronic
1046962790 8:120127426-120127448 GATCCATCCAAAACTGCTCCAGG - Intronic
1047180848 8:122586323-122586345 CATCCATCTCTATCTGCTCCTGG + Intergenic
1049323759 8:142011093-142011115 CCTCCATCCAAATCTTCTCCTGG - Intergenic
1049395719 8:142399350-142399372 CGTCCATCCAGCTGTGGCCCAGG - Intronic
1049671664 8:143872797-143872819 CCTCCAGCCAGCTCTGCCCCAGG + Exonic
1056829317 9:89902044-89902066 CCTCCTTCCAGAGCTCCTCCAGG + Intergenic
1057277271 9:93682663-93682685 CGTCCAAGCAGGTCAGCTCCAGG + Intergenic
1058918088 9:109586795-109586817 CTTCCATCCAGATCCTTTCCAGG - Intergenic
1059437292 9:114284469-114284491 CACCCTTCCAGGTCTGCTCCAGG + Intronic
1061004506 9:127921000-127921022 CTTTCCTCCAGAACTGCTCCGGG - Exonic
1189275288 X:39781009-39781031 CCTCCATCCAAACCTGCTCTGGG - Intergenic