ID: 1016573153

View in Genome Browser
Species Human (GRCh38)
Location 6:145537288-145537310
Sequence TTGAATATACAAATTGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 1, 2: 27, 3: 120, 4: 480}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016573153_1016573154 1 Left 1016573153 6:145537288-145537310 CCATTGTCAATTTGTATATTCAA 0: 1
1: 1
2: 27
3: 120
4: 480
Right 1016573154 6:145537312-145537334 CTCTCGAAACCAATAGAACATGG 0: 1
1: 0
2: 0
3: 8
4: 93
1016573153_1016573155 2 Left 1016573153 6:145537288-145537310 CCATTGTCAATTTGTATATTCAA 0: 1
1: 1
2: 27
3: 120
4: 480
Right 1016573155 6:145537313-145537335 TCTCGAAACCAATAGAACATGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1016573153_1016573157 8 Left 1016573153 6:145537288-145537310 CCATTGTCAATTTGTATATTCAA 0: 1
1: 1
2: 27
3: 120
4: 480
Right 1016573157 6:145537319-145537341 AACCAATAGAACATGGGTTAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1016573153_1016573156 7 Left 1016573153 6:145537288-145537310 CCATTGTCAATTTGTATATTCAA 0: 1
1: 1
2: 27
3: 120
4: 480
Right 1016573156 6:145537318-145537340 AAACCAATAGAACATGGGTTAGG 0: 1
1: 0
2: 5
3: 24
4: 380
1016573153_1016573159 11 Left 1016573153 6:145537288-145537310 CCATTGTCAATTTGTATATTCAA 0: 1
1: 1
2: 27
3: 120
4: 480
Right 1016573159 6:145537322-145537344 CAATAGAACATGGGTTAGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016573153 Original CRISPR TTGAATATACAAATTGACAA TGG (reversed) Intronic
900838184 1:5023110-5023132 TTGAATGGACCAATTGAGAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
903299657 1:22369731-22369753 TTGAATGGACCAATTGTCAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906742990 1:48200630-48200652 TTGAATAAAGAATTTGCCAAAGG - Intergenic
907687038 1:56622380-56622402 TTTTAAATAAAAATTGACAAGGG - Intronic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909833207 1:80220614-80220636 TACAATAAACAAATTGAAAATGG + Intergenic
909894056 1:81043782-81043804 TTGTATATTCAAATTTATAAAGG + Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910501976 1:87902864-87902886 TTACATATACAATGTGACAAGGG - Intergenic
910745871 1:90574376-90574398 TTAAAGATGCAAATTGATAATGG + Intergenic
910835296 1:91502153-91502175 TTAAATGTAGAAATTGACACTGG + Intronic
910964233 1:92791998-92792020 TTGAATATACACATTCACAGAGG - Intronic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
912026471 1:105180882-105180904 TTCATTTTACAAATTGACACGGG - Intergenic
912364701 1:109123502-109123524 TTGACTATGCAATTTGACTATGG - Intronic
912424089 1:109571050-109571072 TTTAATATACAGATTGGCACTGG + Intronic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912973683 1:114308530-114308552 TTGAATATACAAATTACCTTGGG - Intergenic
913007225 1:114646666-114646688 TTTAATATACAGTTTGACACTGG - Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
916626010 1:166555637-166555659 TTCAAATTACAAATTTACAAAGG + Intergenic
916798988 1:168196660-168196682 ATGAATATACTAATTGATACTGG + Intronic
917491723 1:175503940-175503962 TTGGGTTTACATATTGACAAAGG + Intronic
917629835 1:176880631-176880653 TAAAATATAAAAAGTGACAAAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918868595 1:189936213-189936235 TTGAATATACATACTGATAATGG - Intergenic
919098481 1:193064584-193064606 TTGATTATATAAATTTACCAGGG - Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919159526 1:193809862-193809884 TTAAATATCCAAATTTACCATGG + Intergenic
919203187 1:194385968-194385990 TAGATTATAAAAATTGGCAATGG - Intergenic
919809921 1:201402539-201402561 TTGAATATAGAAAATGAGAAGGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920923300 1:210316704-210316726 TTAAATATACTAATTAAAAATGG + Intergenic
921531065 1:216283836-216283858 TTCAATATGCAAAGTGAAAAAGG - Intronic
922006785 1:221539228-221539250 TTTAATATACAAATTGTGGAGGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923132141 1:231085354-231085376 TTCACAACACAAATTGACAAAGG - Intergenic
923185850 1:231572547-231572569 TTGAATACATAAATTCACAAAGG - Intronic
923907715 1:238403872-238403894 TTGAATATATAAATTGGAAAGGG - Intergenic
923954577 1:239001175-239001197 TTAAATATTCACATTAACAATGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063033525 10:2261079-2261101 TTGAATATATAAACAAACAATGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064826609 10:19410241-19410263 TTAAATCTACAACTTGACATTGG - Intronic
1065792033 10:29269221-29269243 TTGAAAATACAATTTGAGCAAGG - Intergenic
1066538586 10:36419348-36419370 TTGAATATACACATAGCCTATGG + Intergenic
1066645582 10:37604957-37604979 TTGAATATACACATAGCCTATGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068183891 10:53560167-53560189 TATAATAAACAAATTGATAAAGG + Intergenic
1068212471 10:53938582-53938604 TTGGATACACAATTTGAAAACGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069204188 10:65661324-65661346 TGGAATATACAAATTTTTAAAGG - Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071845625 10:89518437-89518459 TTGCATGTACAAATTGCCTAAGG - Intronic
1072393157 10:95010173-95010195 TGGAATTTTCAAATTGAGAAAGG - Intergenic
1072775472 10:98187649-98187671 TCATATATACAAATTGAGAAAGG + Intronic
1074294658 10:112173001-112173023 TGGAACATTCAAATTCACAAAGG - Exonic
1074658816 10:115627082-115627104 GTGAATACACAAAGTGACACCGG - Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075548143 10:123371541-123371563 TTCAATACACAATCTGACAAAGG - Intergenic
1075865150 10:125712225-125712247 TGTAATATACAGATTGACACAGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077571627 11:3344247-3344269 AAGAAAATACAAATTCACAATGG + Intronic
1078670277 11:13358112-13358134 TTCAAAATCCAATTTGACAAAGG + Intronic
1078775028 11:14385873-14385895 TTGATTAAGCAAATTGACCAGGG - Intergenic
1080944469 11:36956040-36956062 CTGAATATACAATTTGAAATAGG - Intergenic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081245593 11:40762869-40762891 TCTAAAATACAAATTTACAAGGG - Intronic
1082178628 11:49091345-49091367 TTGAAAATTAAAATTGATAATGG - Intergenic
1082705468 11:56489588-56489610 TTAATTATACAAATTCACACAGG - Intergenic
1082837556 11:57662732-57662754 TAGAATAAACAAATTTAAAAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083370575 11:62175921-62175943 ATGAATATACAAAATCAAAAAGG - Intergenic
1083837370 11:65280156-65280178 TTGAATGTAAACATTGACAAAGG - Intronic
1085370218 11:75996358-75996380 ATGAATAAATGAATTGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087941859 11:104107099-104107121 TAGAATATAAAATGTGACAAAGG + Intronic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1088933002 11:114371093-114371115 TTTAATATTCAAATTGACCCTGG - Intergenic
1089873512 11:121697574-121697596 TAGAGTATACATATTAACAAGGG - Intergenic
1090567605 11:128012382-128012404 TTGAATGTACATATACACAATGG + Intergenic
1090992596 11:131832822-131832844 TTAAATATATATATAGACAAGGG + Intronic
1093062094 12:14617817-14617839 ATAAAGATACAAATTGAAAATGG - Intronic
1093087614 12:14884047-14884069 ATGACTATAAAAATTGCCAAAGG - Intronic
1093228147 12:16510571-16510593 TTAAAAATACAAATTCAAAATGG - Intronic
1093254402 12:16848836-16848858 TTGTATATACAAACTGAGCATGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098352513 12:69578851-69578873 TTTCATATACAATTTGGCAATGG - Exonic
1098773221 12:74581460-74581482 TGGAATAAACAAAATGAAAAAGG + Intergenic
1099256749 12:80323927-80323949 TAGCATATACAACTTGAGAATGG - Intronic
1099472178 12:83064389-83064411 TTGAATAAACATATTTTCAAAGG - Intronic
1099801696 12:87465101-87465123 TTAAATACACAGAATGACAAAGG + Intergenic
1100755013 12:97741654-97741676 TTAAATATATAAATTAACAAAGG - Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101703773 12:107200554-107200576 TTGATGATTCAAATTGAAAAAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1102754721 12:115328194-115328216 TTGAATCTACAAATTTACTTTGG + Intergenic
1103264859 12:119620636-119620658 TTGAAAATAAAAAGTTACAAAGG + Intronic
1103839703 12:123852232-123852254 TTGAATCTACATATTCTCAAAGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104369595 12:128212048-128212070 TTGAATATATTGAATGACAAAGG - Intergenic
1104494511 12:129224384-129224406 TTAAATATACACATTTAAAATGG + Intronic
1104599947 12:130146034-130146056 TTGGATGGACAAATTGGCAAGGG - Intergenic
1106048070 13:26164096-26164118 TTGAATATACAGGTTGACAGTGG + Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107404837 13:40102753-40102775 GTGAATAAACAAATTCACTAAGG - Intergenic
1107607532 13:42075482-42075504 TTTTATATACAGATTAACAATGG - Intronic
1107678868 13:42826746-42826768 TTGAATATAGAAATTAACATGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108205978 13:48090927-48090949 ATTAATATACAAATTGTCTATGG + Intronic
1108219796 13:48221762-48221784 TTGAAAATACCATTTGACCATGG + Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108897314 13:55348506-55348528 TTGATTAAATAAATTGAAAAAGG - Intergenic
1109242955 13:59913617-59913639 TGGAATTTATAATTTGACAAGGG - Intronic
1109418781 13:62081038-62081060 TTTAATAAAAAAATTTACAAAGG - Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109746941 13:66636829-66636851 TTGAATATAAAATTTTACCATGG - Intronic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110297233 13:73882080-73882102 TTGAAAATACAAAGTGAGGAGGG + Intronic
1110372654 13:74757038-74757060 TGGAATGTACAGATTAACAATGG + Intergenic
1110627082 13:77663486-77663508 TTCAACATACAAGTTGACCATGG + Intergenic
1111325207 13:86685299-86685321 TTGAATAAACAAATAAATAAAGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113157637 13:107342310-107342332 TGGCAAAAACAAATTGACAAAGG + Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114313270 14:21487253-21487275 TTGAATGTACCAAATGACCAAGG + Intronic
1114433610 14:22684620-22684642 TTTAATAATCAAATTGCCAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114877897 14:26745470-26745492 TTCCAATTACAAATTGACAAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115403822 14:32993607-32993629 TTGAATATAAAAATACAAAATGG - Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117128501 14:52659212-52659234 ATGAATTTAAAAATTCACAAAGG + Intronic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1118713559 14:68542642-68542664 TTTGATATAAATATTGACAACGG - Intronic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1120554722 14:85915599-85915621 ATTCATATACAAATTGACAGAGG - Intergenic
1120976446 14:90253331-90253353 GTTAATATACAAATTGCCATTGG - Intergenic
1121751338 14:96359900-96359922 TTTAATATACAAATGGGCACTGG + Intronic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1122357095 14:101129630-101129652 TAAAAAATAGAAATTGACAATGG + Intergenic
1123885238 15:24719744-24719766 GTGACTATACTAATTGTCAAAGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125174054 15:36799629-36799651 TTGAATAAACAAAATGCCAAAGG - Intronic
1126427493 15:48545209-48545231 TTAAATATAAAAATTGTCAGGGG + Intronic
1126950863 15:53879462-53879484 TTTGATATAAAAATTGAAAAAGG - Intergenic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1127407258 15:58663622-58663644 TTGAATCTACAAATCAATAAAGG + Intronic
1127751898 15:62054049-62054071 TTGAAAAATCAAATTGACAAAGG + Intronic
1128188089 15:65661737-65661759 TTGAAAATACAATTTGTAAATGG - Exonic
1128864834 15:71106608-71106630 TTGTAAATACAACTTGGCAATGG - Intronic
1128973348 15:72129195-72129217 TTAAAAATACTAATTTACAATGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131564860 15:93476894-93476916 TTGAATAAAGAAAATGACTAAGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1135221533 16:20618628-20618650 TTAAAAATACAAACTCACAATGG + Intronic
1135233578 16:20733171-20733193 TTCAATAACCAAACTGACAAAGG + Intronic
1135381303 16:21998196-21998218 TTGAATTTACAAACTGAGATAGG - Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135896217 16:26405557-26405579 TTGAATATATAAATTAACTGAGG - Intergenic
1135995279 16:27243419-27243441 TTGAACATACAAACAGCCAATGG + Intronic
1136068371 16:27773743-27773765 TTGATTATGCATAGTGACAATGG + Intronic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1137749704 16:50850620-50850642 TTCTTTATAGAAATTGACAAGGG - Intergenic
1138829726 16:60360547-60360569 TTCAACATACAAGTTGACCATGG + Intergenic
1138996973 16:62467268-62467290 TTGAAACTATTAATTGACAAAGG - Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1148341201 17:46874537-46874559 TGGAATTTACAAATTCACTATGG - Intronic
1148378518 17:47173529-47173551 TTGATTATACCAATAAACAATGG + Intronic
1149944063 17:60901844-60901866 TTTAAAAAACAAAATGACAAGGG - Intronic
1150070629 17:62147181-62147203 TTGTATTTACAAATTTACAATGG + Intergenic
1152084383 17:78208818-78208840 TTTAATTTATAAATTGGCAAAGG + Intergenic
1153453391 18:5254572-5254594 TTGAATGTTCAAGTTTACAAGGG - Intergenic
1153545913 18:6204464-6204486 TTGCATATACCACCTGACAAAGG + Intronic
1155081988 18:22419466-22419488 TGCAACATATAAATTGACAAAGG + Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156068006 18:33168520-33168542 TTGTATAAACAAATTAACAAAGG - Intronic
1157001936 18:43537194-43537216 ATGTACAAACAAATTGACAAAGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158311354 18:56162646-56162668 TTGAGTGTAAAAATTCACAAAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158975876 18:62711386-62711408 TTGAAAGAACAAATTGATAAAGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159501548 18:69277589-69277611 TTGAATACATAAATTAAAAAAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159817158 18:73089222-73089244 TTGAATATAGATATAGACATAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164287449 19:23831829-23831851 TTGAATTTAAAAATTTATAAAGG - Intergenic
1167949253 19:53013209-53013231 TTGTGTTTACAAAGTGACAACGG + Intergenic
1168561021 19:57383383-57383405 TTGACTATAGAAATCAACAATGG - Intronic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926372615 2:12195316-12195338 TTTAAAATACAAATTGAAAATGG + Intergenic
926511870 2:13791677-13791699 TTCAACATACAAATTTACAGGGG + Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927558561 2:24052629-24052651 TTAAATATACAAAATGATTATGG - Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930380869 2:50625983-50626005 TTGAATATAAATGTTGACAGTGG - Intronic
930692656 2:54380302-54380324 TTGATGAGACAAATTGCCAAAGG + Intronic
931082923 2:58795700-58795722 GTGAAGATAAAAATTGAAAAGGG - Intergenic
932063643 2:68530322-68530344 TTCAACATACAAGTTGACCATGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936769638 2:115895578-115895600 ATGAATCTACAAATTGATATCGG + Intergenic
937565302 2:123278617-123278639 TAGGATATACAAAATGTCAAGGG + Intergenic
937686477 2:124703629-124703651 TTGAATATACCAAATGCCTATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939351928 2:141049661-141049683 TTGCATCTACAAATTGTCAGAGG + Intronic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940644045 2:156371830-156371852 TTGAATCTACAAATTAACCTTGG + Intergenic
940690121 2:156906239-156906261 TTTAATATTCAAAATGACATTGG - Intergenic
940746753 2:157575854-157575876 GACACTATACAAATTGACAAGGG + Intronic
940959746 2:159771764-159771786 TTTAATATAAAACTTGACATTGG - Exonic
941129524 2:161629193-161629215 TTTACTATATAGATTGACAATGG - Intronic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941425220 2:165335938-165335960 TTGAATAGACATATTGAAAAAGG + Intronic
941462816 2:165792132-165792154 TTGAATCTCCAAAGTGAGAAAGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
943001857 2:182337901-182337923 TTGAGGATGAAAATTGACAAAGG - Intronic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943619656 2:190134354-190134376 TAAACTATACAAATTGAGAAAGG + Intronic
943860228 2:192852656-192852678 TTGAGTATAAAAATTTACTATGG + Intergenic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944266839 2:197736737-197736759 TTGAATTTACAAATCAAAAAAGG - Intronic
944330504 2:198460617-198460639 TAGAATATAAATATAGACAAAGG - Intronic
944573352 2:201067275-201067297 TTAAGTATTCAAAATGACAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945611288 2:212006816-212006838 TTTAATAAATACATTGACAATGG - Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
946936626 2:224728493-224728515 TAGTATACACAAAATGACAATGG + Intergenic
947131110 2:226925856-226925878 TTGAATATCCACAATGACACTGG - Intronic
947681701 2:232039716-232039738 CTTAATATTCCAATTGACAAAGG - Intronic
948676797 2:239601569-239601591 GTGAAAATCCAAACTGACAAAGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169241497 20:3985086-3985108 TGGAATAGACAAATTGATTATGG - Intronic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174940912 20:54926118-54926140 TAGAATATACAGATAGGCAATGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175830731 20:61964348-61964370 TTGAATCTACAAATTGATTTGGG - Intronic
1176322035 21:5337751-5337773 TAGAATCTGCAAATTGACATTGG + Intergenic
1176479691 21:7269536-7269558 TAGAATCTGCAAATTGACATTGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176932989 21:14835657-14835679 ATACATATACAAATTGACACAGG - Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177848467 21:26318968-26318990 TTGAATATAAAAATTCTTAAGGG - Intergenic
1178086393 21:29115903-29115925 TTGAATCTAAAAAATGACAGAGG + Intronic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178951170 21:36987004-36987026 TTGAATATCAAAATTAATAATGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182156854 22:28082219-28082241 ATAAATATCCAAATTGAAAAGGG - Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950844875 3:16005664-16005686 TTGAATATATAATTTGAAAAAGG + Intergenic
950987410 3:17389700-17389722 TTGAATCTACAACTTGAGCAGGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952230209 3:31421519-31421541 TTGAATATGCAAATATGCAAAGG - Intergenic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953191630 3:40693284-40693306 TTTAATATATGAATTGACACTGG - Intergenic
953275046 3:41486807-41486829 TTGTGTATACAAATGGTCAATGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
954203138 3:49037260-49037282 TTGAATATACAGATTGATTCCGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956650205 3:71498013-71498035 TTAAATATGTAAATTGAAAAGGG - Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956857101 3:73286131-73286153 ATGAAGATATAAATTGCCAAGGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
958666691 3:97148748-97148770 TTAAATATAAAAATTGAAAATGG - Intronic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959554690 3:107703142-107703164 TTCAGTTTACAAATTCACAAAGG - Intronic
959750951 3:109834362-109834384 TTGAGTATGCAACTTGACAATGG - Intergenic
960312192 3:116130580-116130602 TTGAAAATATAATTTGAAAATGG + Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
962323376 3:134409651-134409673 TGGAATTTTCAAATTAACAAGGG + Intergenic
962675583 3:137755270-137755292 TTGAATCTACAAATTACCATGGG - Intergenic
963287819 3:143453170-143453192 TTGAATACACAAATTAACATAGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964731688 3:159873733-159873755 TTAAATAGAAAAAATGACAAAGG - Intronic
965380474 3:167981931-167981953 TTGAATTTACACATTTAAAAAGG - Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966091910 3:176148638-176148660 TTTAATATATAAATTGCCTATGG - Intergenic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
966614713 3:181901007-181901029 TAGAATATACAATTTAACACTGG + Intergenic
966843819 3:184110768-184110790 TTAAATATTCACATTGAAAAAGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968198869 3:196734786-196734808 TTGAATATATGAATTGGCAAAGG + Intronic
970179127 4:13370627-13370649 TTAAATATAAAAATTGTAAATGG - Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971491881 4:27221250-27221272 TTGAATAAACAAATTCAACAAGG - Intergenic
971646493 4:29213029-29213051 TTGTTTATACAAATTAACACAGG - Intergenic
972094993 4:35337449-35337471 TAGAATATACAAAGTCACCAAGG + Intergenic
972793547 4:42395270-42395292 TTGAAGTTAAAATTTGACAATGG + Intergenic
972809631 4:42568504-42568526 ATGAAAATATAAATTCACAAAGG + Intronic
972904972 4:43734565-43734587 AAGAGTATACAAATTGAAAAGGG + Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973695861 4:53490385-53490407 TTGACTTGAGAAATTGACAATGG + Intronic
974306414 4:60147752-60147774 TTGACAATTCAAATTGATAATGG + Intergenic
974497835 4:62656273-62656295 TTGAATAAAGAAATTGGCAAAGG - Intergenic
975408598 4:74021868-74021890 TTGAAAATACAACTTAGCAATGG + Intergenic
976292088 4:83429880-83429902 TTGCATATATAAATTTATAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
976927493 4:90517571-90517593 TTGAATATACAGATTTAAACTGG + Intronic
977076570 4:92459545-92459567 GAGAATATACTAATTGACATAGG - Intronic
977113339 4:92988785-92988807 TGGAATAAACAAACTGACAAAGG + Intronic
977239249 4:94546841-94546863 TTGAATATTCAGGTTGAAAAAGG - Intronic
977829228 4:101570771-101570793 TTGAATATATCAACAGACAATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978122286 4:105094158-105094180 TGGAATATATGATTTGACAATGG - Intergenic
978382585 4:108145161-108145183 TTTAACATACAAATTGCCACTGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979993698 4:127406098-127406120 TTTAATTTTCAAATTTACAAAGG - Intergenic
980174709 4:129330544-129330566 TTGAAGATACAAAGTTGCAAGGG + Intergenic
980209861 4:129773172-129773194 TTGAATATACAAGTTGGGGACGG - Intergenic
980267992 4:130544975-130544997 TAAAATATACAAATTAACATTGG - Intergenic
980519011 4:133906520-133906542 TTGAATAAACATAGTGAAAATGG + Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981134743 4:141197541-141197563 TAGAAAATACAAATTGTAAAAGG - Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
982798245 4:159671045-159671067 TTGAATATACAAAGTTGCAGAGG - Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983658952 4:170112552-170112574 TTGAAAATTCTAATTGCCAATGG + Intergenic
984213508 4:176879499-176879521 TTAAAAATAGAATTTGACAAGGG + Intergenic
984435047 4:179699146-179699168 ATGAACATGCAAATTGACTAGGG - Intergenic
984449405 4:179879964-179879986 ATGAATATAAAAAGTGACATTGG - Intergenic
984962038 4:185107099-185107121 TTTTATAAACAAATTGAAAAAGG + Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987588440 5:19890458-19890480 TTGAATATATAAATGTCCAATGG + Intronic
987874378 5:23660999-23661021 TTAAATAAACATATTGAGAAGGG - Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989013707 5:36903946-36903968 TTGAATATAGAAATATAGAAAGG + Intronic
989230450 5:39080438-39080460 TTTATTATACATATTAACAATGG - Intergenic
989415606 5:41171869-41171891 TTAAAAATACAGACTGACAAGGG - Intronic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992623818 5:78618814-78618836 TTGAACATACACATTGAAAAAGG + Intronic
992918468 5:81485183-81485205 TTGACTATACAATTTTACACTGG - Intronic
992979676 5:82155931-82155953 TTGAATATAATAATTGATAAAGG + Intronic
993299559 5:86190793-86190815 TTGCATCTACAAATAGGCAAAGG + Intergenic
994567047 5:101462592-101462614 TTGAAAATAAAATTTAACAAAGG - Intergenic
994946744 5:106403610-106403632 TTGAATATAAAAAGCGAAAATGG - Intergenic
994979145 5:106850565-106850587 TTGAATACAAAAGTTGAAAATGG - Intergenic
995096543 5:108241700-108241722 TTTAATAATCAAATTCACAATGG + Intronic
995689550 5:114809096-114809118 TTTAGTATCCAAATTGACACTGG - Intergenic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996166734 5:120232980-120233002 TTGAATCTACAAATTGCTTAGGG + Intergenic
996424480 5:123298967-123298989 TGGATTATACAAATTCCCAAAGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997831770 5:137156594-137156616 GTGAATATACATGTTGAAAAGGG + Intronic
998359230 5:141570623-141570645 TTAAAAATACTAATTGACTAGGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999558333 5:152770246-152770268 TTCACTCAACAAATTGACAACGG + Intergenic
999579253 5:153016876-153016898 TTTAATTAACAAATTGTCAATGG + Intergenic
999598361 5:153232096-153232118 TTAAATAAACAAACTGACACTGG - Intergenic
999826935 5:155282555-155282577 TTGATTATACACATTCTCAAAGG - Intergenic
999901295 5:156089451-156089473 TTCACTATACAAAATGACAACGG - Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000759995 5:165210993-165211015 TTAAATATACGAATTGAAAATGG + Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1004011159 6:11689058-11689080 GTGAATATACAAAGTAGCAAAGG - Intergenic
1004109876 6:12706977-12706999 TTGAATAGACACATTGCCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004481905 6:16028483-16028505 TTGACTTTACAAATTGACTTGGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005801866 6:29433671-29433693 TTGAATATATACACAGACAAGGG + Intronic
1006006115 6:31002986-31003008 TTTAATAGACAAATTGAAAGAGG + Intergenic
1006861866 6:37177154-37177176 CTTAATATATGAATTGACAATGG - Intergenic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008622684 6:53287060-53287082 TTTAAAATAAAAATTGAAAAGGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1009398933 6:63231195-63231217 TTCAACATACAAGTTGACCATGG + Intergenic
1009564050 6:65287789-65287811 TTAAATATTTAAATTCACAAAGG + Intronic
1009768574 6:68115498-68115520 TTGAAATTACATATTTACAAAGG + Intergenic
1010858500 6:80873888-80873910 TTTAAAATTCAAAATGACAACGG + Intergenic
1011003722 6:82620645-82620667 TCGCACATACAATTTGACAAGGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011607049 6:89116288-89116310 TTGAACAGACAACTTGAAAATGG - Intronic
1012181454 6:96158481-96158503 TTGAATTTATGATTTGACAAGGG + Intronic
1012328844 6:97958772-97958794 TTCATTAAACAAATTGATAACGG - Intergenic
1012564303 6:100627734-100627756 TTCAATATAAAAATTGAAAATGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015256735 6:131186096-131186118 TTCAACATACAATTTGAGAAGGG - Intronic
1015641868 6:135343076-135343098 TAGAATATACAGATTCAAAAAGG + Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017966103 6:159267847-159267869 GTGAATCCACAAATTGGCAATGG - Exonic
1018002254 6:159589683-159589705 TTGAATAAACAAAATAAAAATGG + Intergenic
1018075643 6:160210286-160210308 TTGAATCTACAAATTACCATTGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018190333 6:161304673-161304695 TTCAACATACAAATTTGCAAGGG + Intergenic
1018624200 6:165761599-165761621 TTGTAAAAATAAATTGACAAAGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020933109 7:14425424-14425446 TTGAATTTACTAATTGTCACAGG + Intronic
1021059102 7:16087854-16087876 TTGAAACTACAAATTCACAGAGG - Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022295256 7:29044713-29044735 TTGAAAAGACAAATCGAGAAAGG - Intronic
1022363843 7:29689438-29689460 TAGAATATTCAACTTGTCAAAGG - Intergenic
1022697524 7:32724301-32724323 TAGAATATTCAACTTGTCAAAGG + Intergenic
1023084277 7:36554551-36554573 TTGAATCTACAAATTGCCTTGGG + Intronic
1023523108 7:41068800-41068822 TTGAATTTAGAAATTGATATCGG + Intergenic
1023581356 7:41687290-41687312 TTTAATCTACAAATTGACATAGG + Exonic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1024841290 7:53590651-53590673 TTTAAAATAAAAATTGTCAATGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1026407125 7:70077953-70077975 TTTAATATTCAGATTGACAGTGG + Intronic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027452384 7:78347146-78347168 TTGGATATACAATTTCACATTGG + Intronic
1027856342 7:83516329-83516351 TTTAAAATATAATTTGACAAAGG + Intronic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028147463 7:87334233-87334255 CTGATTATAAAAATTGGCAAAGG - Intergenic
1028365831 7:90030515-90030537 TTAAATATAAAAATAGGCAAAGG + Intergenic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028688199 7:93617627-93617649 TTAAACATACAAAATGCCAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029876104 7:103753673-103753695 TTGAAAATACAAATTAATAATGG + Intronic
1030397075 7:108999522-108999544 TGGAATAAAAAAATTGACCATGG + Intergenic
1030651766 7:112123689-112123711 TGGAATATACAAGTTGCCATGGG - Intronic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031342856 7:120626384-120626406 TCGAAAATACAAAATGATAATGG - Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032880952 7:136089910-136089932 TTAAATATACTCATTTACAATGG + Intergenic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034109678 7:148524495-148524517 TTGGATATGCACATTGAAAAAGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034828069 7:154285070-154285092 TTGAATATAGATGTTGGCAATGG + Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1037060259 8:14499750-14499772 ATCTATATACAAATTGATAAGGG - Intronic
1037151051 8:15635533-15635555 TTTAATTTAAAAATTCACAATGG + Intronic
1038373318 8:27013226-27013248 TTCAACATACAAGTTGACCATGG + Intergenic
1038378819 8:27072572-27072594 TCCAATATAAAAATTGACAAAGG + Intergenic
1038422722 8:27443703-27443725 TTCAACATGCAAATTGAAAAGGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039528533 8:38237725-38237747 TTCAATATAAAATTTGACAAAGG - Intronic
1039535480 8:38308317-38308339 TTGAAATTACATATTTACAATGG - Intronic
1039730559 8:40271740-40271762 TTGAATATCCATATCCACAATGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041018363 8:53613939-53613961 TTGAATATACAAATTACCTTGGG - Intergenic
1041221079 8:55651734-55651756 TTGAATATACAAATTACCTTGGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041626171 8:60029840-60029862 TTGAATATGCATATTTAAAACGG - Intergenic
1042037283 8:64548501-64548523 TTTAATATACAAATTCTTAAAGG + Intergenic
1042383462 8:68146865-68146887 TGGAAAAAACAAAATGACAAAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043724081 8:83587242-83587264 TAAAAGATACAAATTAACAAAGG + Intergenic
1044060794 8:87632260-87632282 TTGAATATACATAGAGAGAAAGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044465316 8:92496580-92496602 TTGACTAATCAAATTGGCAAAGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045340301 8:101248423-101248445 TGGAATGTACAAAGTCACAAGGG - Intergenic
1045448668 8:102295884-102295906 TTGCATTTAGAAATTAACAAGGG - Intronic
1045558704 8:103239946-103239968 TTGAATATACATATTTACTTGGG - Intergenic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1045674475 8:104591676-104591698 TGTAATATATAAATTGGCAAAGG + Intronic
1046884872 8:119355105-119355127 TTAAAAATAAAAATTGCCAAAGG + Intergenic
1047282974 8:123461680-123461702 TTGAATATACAAAGTTATCAAGG - Intronic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049136881 8:140910376-140910398 TTGAAGATACAAATTTATATTGG - Intronic
1050453802 9:5812559-5812581 TTGTACATACAAGTTGCCAAGGG + Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050511273 9:6398365-6398387 TTGAATACAAAATCTGACAATGG + Intergenic
1050724531 9:8632713-8632735 TTGCTTACACAATTTGACAAAGG - Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051856361 9:21571314-21571336 TTGAATATAAAAATATACCATGG + Intergenic
1052184228 9:25571305-25571327 TTGAATCTACACATTTAAAAAGG - Intergenic
1052220273 9:26013250-26013272 TTGAATACATAAATTGAATAAGG + Intergenic
1052258573 9:26488965-26488987 TTTAATAATCAAATTGCCAAAGG - Intergenic
1052310024 9:27057037-27057059 GTCAATATATATATTGACAAGGG - Intronic
1052413020 9:28147105-28147127 TTCAACATACAAGTTGACCATGG - Intronic
1052557428 9:30034935-30034957 TTTAATATATGAATTGACAAAGG - Intergenic
1052634757 9:31087774-31087796 TTGAATATACAAATTGCTTTGGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056020589 9:82433989-82434011 TTCAACATACAAGTTGACCATGG + Intergenic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1203399886 Un_KI270519v1:77299-77321 TTGAATATACAAATTACCTTGGG - Intergenic
1203413481 Un_KI270589v1:21405-21427 TTGAATCTGCAAATTGACATTGG - Intergenic
1203413573 Un_KI270589v1:23045-23067 TGGAATCTGCAAATTGACATTGG - Intergenic
1203413643 Un_KI270589v1:24409-24431 TGGAATCTGCAAATTGACATTGG - Intergenic
1203413731 Un_KI270589v1:27183-27205 TGGAATCTGCAAATTGACATTGG - Intergenic
1203414099 Un_KI270589v1:33320-33342 TGGAATCTACAAATTGACATTGG - Intergenic
1203684180 Un_KI270757v1:26558-26580 TGGAATCTACAAATTGACATTGG + Intergenic
1203684548 Un_KI270757v1:32695-32717 TGGAATCTGCAAATTGACATTGG + Intergenic
1203684668 Un_KI270757v1:34803-34825 TGGAATCTGCAAATTGACATTGG + Intergenic
1203684738 Un_KI270757v1:36167-36189 TGGAATCTGCAAATTGACATTGG + Intergenic
1203684831 Un_KI270757v1:37807-37829 TTGAATCTGCAAATTGACATTGG + Intergenic
1186155773 X:6724959-6724981 TTAAATAAACAAACTGGCAATGG + Intergenic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1188077075 X:25791131-25791153 TTCATTATACAGATTGAAAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188839879 X:35003214-35003236 ATGAATATACTCATTGGCAATGG + Intergenic
1188905892 X:35791358-35791380 TTGAATATACAAATTTTCTATGG - Intergenic
1189047472 X:37608770-37608792 TTGAATATTCACATTAACATAGG + Intronic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193219851 X:78911665-78911687 TTTAATAATCAAATTGTCAAAGG - Intergenic
1193324634 X:80165403-80165425 GGGAATATACAAGATGACAATGG + Intergenic
1193508166 X:82368698-82368720 TTCAAAATACACATTTACAAAGG - Intergenic
1193658826 X:84231996-84232018 TTGATTGTATAAATTGAGAAGGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195651254 X:107287475-107287497 TTGAAGATAAAAATTAACTAGGG - Intergenic
1195745906 X:108117919-108117941 ATGAAAATAGAAATTGACAGGGG + Intronic
1196480082 X:116137973-116137995 TTGAATATCCAAAATTTCAAGGG + Intergenic
1197704053 X:129621177-129621199 TTAAATATACATAATTACAAAGG - Intergenic
1197978462 X:132191044-132191066 TAGAATATACAATATGACATGGG - Intergenic
1198197689 X:134381370-134381392 TTGCTTAGACAAATTGACACAGG - Intronic
1199106275 X:143873035-143873057 TAGAATAGACAAATTGAAGAGGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201549152 Y:15201072-15201094 TTAAATAAACAAACTGGCAATGG + Intergenic