ID: 1016578098

View in Genome Browser
Species Human (GRCh38)
Location 6:145594075-145594097
Sequence ATGTTGTTATTACTGATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016578097_1016578098 -3 Left 1016578097 6:145594055-145594077 CCAATATAAGTTTTTTAAATATG 0: 1
1: 0
2: 5
3: 86
4: 984
Right 1016578098 6:145594075-145594097 ATGTTGTTATTACTGATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016578098 Original CRISPR ATGTTGTTATTACTGATCCA TGG Intronic
No off target data available for this crispr