ID: 1016580873

View in Genome Browser
Species Human (GRCh38)
Location 6:145628406-145628428
Sequence AGAGTCTACCAGGCCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016580873_1016580875 -1 Left 1016580873 6:145628406-145628428 CCTGCTGAGGCCTGGTAGACTCT 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1016580875 6:145628428-145628450 TGCTCCGCTCTCTCATCCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 91
1016580873_1016580876 0 Left 1016580873 6:145628406-145628428 CCTGCTGAGGCCTGGTAGACTCT 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1016580876 6:145628429-145628451 GCTCCGCTCTCTCATCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016580873 Original CRISPR AGAGTCTACCAGGCCTCAGC AGG (reversed) Intronic
902236589 1:15061478-15061500 AGAGAATCCCAGGCCTGAGCAGG - Intronic
905020278 1:34806001-34806023 AGATTCTGACAGGACTCAGCAGG + Intronic
907267753 1:53273033-53273055 AGAGTCCTCCAGGGCTCAGGTGG + Intronic
912500918 1:110121410-110121432 AGACTCTGCCGGGCCGCAGCAGG - Intergenic
916454629 1:164958348-164958370 AGAGTGTTCCAGTACTCAGCAGG + Intergenic
916853738 1:168728793-168728815 AGAGTCTAGCAGCCCCCAGGAGG + Intronic
917482751 1:175426081-175426103 TGAGTCTCCCTGACCTCAGCAGG - Intronic
918864211 1:189873840-189873862 AATCTCTACCAGGGCTCAGCAGG - Intergenic
918976614 1:191495292-191495314 TCAGTTTACAAGGCCTCAGCTGG + Intergenic
1063539154 10:6914581-6914603 AGAGACTTCCAAGCCTCAGATGG + Intergenic
1064125411 10:12655684-12655706 AAAGACCGCCAGGCCTCAGCTGG + Intronic
1070570104 10:77634621-77634643 AAATTCTACCAGCCCTCAGATGG - Intronic
1073065801 10:100758581-100758603 AAAGACTCCCAGGCCCCAGCAGG + Intronic
1074720869 10:116264064-116264086 GGAGTCATCCAGGACTCAGCTGG + Intronic
1075271876 10:121059486-121059508 AGAGTCTCCCTGGCTCCAGCAGG - Intergenic
1075664422 10:124220608-124220630 AGAGGCACCCATGCCTCAGCAGG - Intergenic
1076711752 10:132339511-132339533 AGAGTGTTCCGGGGCTCAGCTGG + Intronic
1078090067 11:8259552-8259574 GGCCTTTACCAGGCCTCAGCAGG + Intronic
1083404846 11:62449458-62449480 AGGGTCACCCAGGCCTGAGCTGG + Intronic
1085418267 11:76334254-76334276 AGAGAGCACCAGGCCTCAGATGG - Intergenic
1085772021 11:79334234-79334256 ATAGTCTGGCAGGACTCAGCTGG + Intronic
1086147989 11:83575355-83575377 AGAGTCTGCCAGGCTTCTCCTGG - Intronic
1090122153 11:124041461-124041483 AGAGTCTGCCAAGCCCCAGAGGG - Intergenic
1090256281 11:125286828-125286850 AGAGTCTCCCAGGCCTGACTTGG + Intronic
1098312544 12:69162132-69162154 CAACTCTGCCAGGCCTCAGCTGG + Intergenic
1104286856 12:127431642-127431664 AGAAGCTACCAGGCCTCTCCAGG - Intergenic
1104744813 12:131204103-131204125 GGAGTCCACCCGGCCTCAGCAGG - Intergenic
1104789600 12:131473316-131473338 AGAGTCCACCCGGCCTCAGCAGG + Intergenic
1105013046 12:132768444-132768466 AGAGTTAACCAGGCGTAAGCTGG - Intergenic
1106508147 13:30389687-30389709 AGAGTCTACCAGCCCTGTCCGGG - Intergenic
1106846278 13:33741248-33741270 AGATTCTAACAGGCCTCAGAAGG - Intergenic
1107629075 13:42324886-42324908 ACTGTCTACAAGGCCCCAGCAGG - Intergenic
1107988352 13:45795420-45795442 AGAGTTTCCCAGCACTCAGCAGG + Intronic
1111935155 13:94550047-94550069 AGGGGCTACCAGGCCTGGGCAGG - Intergenic
1112718813 13:102218340-102218362 AGGGTCTACCAGGCCCACGCTGG + Intronic
1113069186 13:106403060-106403082 AGAGTCTCCCAGACCTCGGCAGG + Intergenic
1114529522 14:23387215-23387237 AGAGTCAAACAGGCCTGAGTTGG - Intronic
1122304293 14:100751984-100752006 AGAATTTACAAGGCCTAAGCTGG - Intergenic
1122425242 14:101601882-101601904 ACAGTCTGCTAGGCCTCGGCAGG + Intergenic
1122440809 14:101730700-101730722 AGAGCCTGCCAGGCCCCACCTGG - Intronic
1124077734 15:26461875-26461897 ATAGTCTACCAGGGCGCAGGAGG - Intergenic
1124867503 15:33507589-33507611 AGTGTCTACCAACCTTCAGCAGG + Intronic
1129313121 15:74725948-74725970 ACAGCCTACCAGGACTCGGCAGG + Intergenic
1129389904 15:75215274-75215296 GGAGTCATCAAGGCCTCAGCAGG - Intergenic
1132033456 15:98458327-98458349 CAAGTCTACCAGGCTCCAGCTGG - Intronic
1132383287 15:101381626-101381648 TGAATCCACCAGGCCTGAGCAGG - Intronic
1132630771 16:916167-916189 AGAGTTAATGAGGCCTCAGCTGG - Intronic
1132944658 16:2526299-2526321 AGAGTCTAGCAGTGCTCAGAGGG + Intronic
1134846697 16:17446779-17446801 AGACTCAACCAACCCTCAGCGGG + Intronic
1138539399 16:57679320-57679342 AGTGGCTGCCAGGCCTGAGCAGG - Intronic
1141136475 16:81468837-81468859 AGCGTGTGCCAGGCCTCACCAGG - Intronic
1142490560 17:275929-275951 AGAGTGTGCCAGTCCACAGCGGG + Intronic
1142803116 17:2357309-2357331 AGAATGTACCTGGGCTCAGCTGG + Intronic
1143864143 17:9911696-9911718 AGAGGCTGCCAGGACTCTGCTGG - Intronic
1144654818 17:17028752-17028774 AGAGCCTGCCAGGCCCCAGGGGG - Intergenic
1147162164 17:38574658-38574680 AAAGTCAACCAGGCCTGAGGAGG + Intronic
1148575348 17:48706602-48706624 ACAGTCTAGCAGGCCTCTGGTGG + Intergenic
1150218840 17:63484630-63484652 ACAGGGTACCAGGGCTCAGCTGG - Intergenic
1154155464 18:11940887-11940909 AGAGTCGACCAGCCCACAGGAGG - Intergenic
1155231426 18:23778715-23778737 AGTGACCACCAGGCCTCTGCTGG - Intronic
1157093045 18:44659089-44659111 AGATTTAACCAGGCCTCAGAAGG - Intergenic
1158370455 18:56796472-56796494 AAACTCTACAAAGCCTCAGCTGG + Intronic
1160700506 19:504693-504715 AGAGCCCTCCAGGCCTCTGCAGG - Intronic
1161621698 19:5301136-5301158 AAAGGCTTCCAGGCCACAGCCGG + Intronic
1162370356 19:10275091-10275113 AGATTCCCCCAGGCCTCTGCAGG - Intronic
1167605660 19:50480312-50480334 TGAGTCTCCCAGGCCTCTGCGGG - Intronic
925151396 2:1617853-1617875 AGAGTGCACCAGCCCTCGGCTGG + Intergenic
925353329 2:3218488-3218510 AGAGTATACCAGGGCCCTGCTGG - Intronic
925353386 2:3218956-3218978 AGAGTATACCAGGGCCCTGCTGG - Intronic
926412363 2:12617577-12617599 AAATTCTCCCAGGCCTCAGAGGG - Intergenic
926862619 2:17324975-17324997 AGAGTATTCCTGGCCTCAGGAGG - Intergenic
928911582 2:36427350-36427372 AGAGTCTTTCAGCCATCAGCAGG + Intronic
930405951 2:50955921-50955943 AGAGTCTGCCGGGCAGCAGCTGG + Intronic
931832389 2:66066187-66066209 TGAGTCTCCCAGGCCTCTGCTGG - Intergenic
935183211 2:100708325-100708347 TGAGTTGACTAGGCCTCAGCTGG + Intergenic
935633876 2:105235015-105235037 AGAGTCTCCCAGCCACCAGCTGG + Intergenic
943728908 2:191281211-191281233 AGACTCAACCAGGCCACAGATGG - Intronic
948408099 2:237738024-237738046 TGAGTTTGCCAGGCCTCATCTGG + Intronic
1168839818 20:902861-902883 ACAGTCTTCCAGGCCCCAGAAGG - Intronic
1169939910 20:10925696-10925718 AGAGTCTAGAAGTCCTCAGATGG - Intergenic
1171195803 20:23198258-23198280 AGAGTCTGCCAGGCTCCAGCTGG + Intergenic
1173177989 20:40779169-40779191 AGAGTCTTCCAGCCCAAAGCTGG + Intergenic
1177528737 21:22332947-22332969 AGAATCTATCAGGCCTAGGCAGG + Intergenic
1178960164 21:37057786-37057808 AGAGCCATCAAGGCCTCAGCAGG - Intergenic
1179616430 21:42586491-42586513 AGAAGCCACCAGGCCACAGCAGG + Intergenic
1179616467 21:42586607-42586629 AGAAGCCACCAGGCCACAGCAGG + Intergenic
1179616482 21:42586655-42586677 AGAAGCCACCAGGCCACAGCAGG + Intergenic
1184424898 22:44403530-44403552 TGGGTCCCCCAGGCCTCAGCGGG - Intergenic
1185388136 22:50545885-50545907 AGGGTCTACCAGGCAGAAGCAGG + Intergenic
950564626 3:13761013-13761035 ATACTTTACCAGGCCCCAGCGGG - Intergenic
950730826 3:14955521-14955543 AGAGTCAAAGAGGCCTCAGTTGG + Intronic
950935598 3:16835775-16835797 AGAGGCCACCAGGCCTCACACGG + Intronic
952979544 3:38723656-38723678 GCAGTGTTCCAGGCCTCAGCTGG - Intronic
953356027 3:42256947-42256969 AGGGTCTTGGAGGCCTCAGCAGG + Intergenic
954258932 3:49425033-49425055 AGGGTCTCCCAGACCCCAGCAGG - Exonic
963531373 3:146476676-146476698 TGAGTCTCCCAGGCACCAGCCGG - Intronic
972481552 4:39501600-39501622 AGAGTCTGAAAGGCCCCAGCTGG + Intronic
986169220 5:5302158-5302180 TGTGTCTACCAAGCCTCAGCTGG - Intronic
989608785 5:43272065-43272087 AGAATCTACATGTCCTCAGCTGG - Intronic
990324835 5:54664882-54664904 AGAGTCTACCTTCCTTCAGCTGG + Intergenic
992747280 5:79832121-79832143 ACAGACTTCCTGGCCTCAGCTGG + Intergenic
995130594 5:108626420-108626442 AGAGTCTGTCAGCCCACAGCAGG + Intergenic
995750837 5:115451872-115451894 ATAGAGTTCCAGGCCTCAGCAGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
997388573 5:133495220-133495242 AAACTCGACCAGGCCTCTGCGGG + Intronic
997465225 5:134083620-134083642 CCAGACTTCCAGGCCTCAGCTGG + Intergenic
997907704 5:137835832-137835854 AGATTCTACCTGGCCTCCCCAGG - Intergenic
998545445 5:143023639-143023661 AGAGGCTGCCAGGCCTCTGCTGG + Intronic
1001945272 5:175773022-175773044 TGGGTTTACCAGCCCTCAGCAGG - Intergenic
1002200631 5:177525822-177525844 TGAGCCTTCCAGGCCTCACCTGG - Intronic
1002329563 5:178432379-178432401 AGTGACTACCACCCCTCAGCTGG + Intronic
1003605803 6:7559484-7559506 AGAGTCTTCTAGACCTCAGGTGG + Intronic
1006778750 6:36617334-36617356 AGGGTTTTCCAGGCCACAGCAGG + Intergenic
1011246011 6:85322080-85322102 AGACTAGAACAGGCCTCAGCTGG - Intergenic
1011931183 6:92716099-92716121 GCAGTCTACCAGAGCTCAGCTGG + Intergenic
1012812882 6:103983385-103983407 TGAGTCTACCAGAACTCAGGAGG + Intergenic
1016580873 6:145628406-145628428 AGAGTCTACCAGGCCTCAGCAGG - Intronic
1018870073 6:167775921-167775943 AAAGTCTATCAGGACACAGCAGG - Intergenic
1021026881 7:15679018-15679040 AGAGTCCAGCAGGCTTAAGCTGG - Intronic
1022468157 7:30665245-30665267 AGTCTCTACCTGGCCTCAGGGGG - Intronic
1025731207 7:64109761-64109783 ACAGTCTACCCCGCCTTAGCAGG - Intronic
1028590984 7:92494325-92494347 CTAGTCGACCAGGCCTAAGCAGG + Exonic
1031783923 7:126004923-126004945 AGAGGCTACCAGTAATCAGCTGG - Intergenic
1034514304 7:151562306-151562328 AGGGTCTCCCAGGGCGCAGCCGG - Intronic
1035207943 7:157306958-157306980 CAAGTCCACCAGGGCTCAGCGGG - Intergenic
1035406502 7:158602121-158602143 GGAGTCTGCCAGGACTCAGGCGG + Intergenic
1035736554 8:1891573-1891595 AGAGGCTCCTAGGCCTGAGCTGG - Intronic
1042657447 8:71115454-71115476 AAAGTCTTCCAGGTCTCAGCAGG + Intergenic
1042847883 8:73186503-73186525 CGAGACTATGAGGCCTCAGCTGG - Intergenic
1042847989 8:73187342-73187364 TGAGGCTATGAGGCCTCAGCTGG + Intergenic
1047483594 8:125308067-125308089 ACAGTTTACCAGGCCCCACCTGG + Intronic
1048634509 8:136281408-136281430 GGAGCCTACCAGGCCTCAATAGG - Intergenic
1051135006 9:13910203-13910225 TGAATTTACCAGGCTTCAGCGGG + Intergenic
1053070148 9:35096365-35096387 AGAGTCGACTGGGCCTCCGCTGG + Exonic
1055261358 9:74437568-74437590 CAAGTCAACCAGGCCTAAGCTGG + Intergenic
1060930977 9:127489414-127489436 ACAGACCACCAGCCCTCAGCAGG - Intronic
1061457874 9:130712588-130712610 AGAATCTACCAGGTCCCAGGAGG + Intergenic
1187824395 X:23320146-23320168 ACAGTCTACCAGGACACTGCTGG + Intergenic
1190070240 X:47273492-47273514 AGGGTCTCCCAGACCCCAGCAGG - Intergenic
1192263590 X:69523796-69523818 AGAGTCTAACATGCCAGAGCAGG + Intronic
1195721295 X:107871709-107871731 AGAGTCTAGCTGTCCCCAGCTGG + Intronic
1198229578 X:134676298-134676320 AAAGTGCACCAGGCCTCGGCAGG - Intronic
1199975624 X:152893463-152893485 GGAGGCTGCCTGGCCTCAGCTGG - Intergenic
1200009118 X:153108193-153108215 AGTGTCTGCCAGCCCACAGCGGG - Intergenic
1200030482 X:153291729-153291751 AGTGTCTGCCAGCCCACAGCGGG + Intergenic
1200923500 Y:8633889-8633911 AGACACTGACAGGCCTCAGCTGG - Intergenic