ID: 1016581132

View in Genome Browser
Species Human (GRCh38)
Location 6:145630249-145630271
Sequence GTGCAATGGTTGAGTGATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016581132_1016581135 29 Left 1016581132 6:145630249-145630271 CCGGAATCACTCAACCATTGCAC 0: 1
1: 0
2: 2
3: 3
4: 126
Right 1016581135 6:145630301-145630323 AAAGAATAAATACTTAAGAAGGG No data
1016581132_1016581134 28 Left 1016581132 6:145630249-145630271 CCGGAATCACTCAACCATTGCAC 0: 1
1: 0
2: 2
3: 3
4: 126
Right 1016581134 6:145630300-145630322 TAAAGAATAAATACTTAAGAAGG 0: 1
1: 0
2: 5
3: 67
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016581132 Original CRISPR GTGCAATGGTTGAGTGATTC CGG (reversed) Intronic
903943402 1:26946895-26946917 GAGCAAAGGTTGAGTTTTTCTGG + Intergenic
907343500 1:53754938-53754960 GAGCAAGGGTTGAGTGAGCCAGG + Intergenic
911262990 1:95709459-95709481 GTGGAGTGGTTGGGTGATTGGGG + Intergenic
916632430 1:166630957-166630979 ATTCAATGATTGAGTGATGCTGG + Intergenic
919634527 1:199990569-199990591 GTGCAATGGTGGCGTGATCTTGG + Intergenic
919999665 1:202787837-202787859 GTGCAATGGTGGTGTGATCTTGG - Intronic
920148136 1:203880616-203880638 GTGCAATGGTGGCGTGATCTCGG - Intergenic
920168883 1:204057268-204057290 GTGGCTTAGTTGAGTGATTCTGG + Intergenic
922198254 1:223378311-223378333 GGGAATTGGTTGAGTGATTGGGG + Intergenic
924704044 1:246484006-246484028 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704052 1:246484110-246484132 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704056 1:246484162-246484184 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704076 1:246484422-246484444 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704080 1:246484474-246484496 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704084 1:246484526-246484548 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704088 1:246484578-246484600 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704092 1:246484630-246484652 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704096 1:246484682-246484704 GTGCAATGGTTTAGGTATTTTGG - Intronic
924704100 1:246484734-246484756 GTGCAATGGTTTAGGTATTTTGG - Intronic
1064017835 10:11786526-11786548 GTCCCATGGTTCTGTGATTCTGG - Intergenic
1064187530 10:13175365-13175387 GTGCAATGGTGGCGTGATCTGGG - Intronic
1064958282 10:20935560-20935582 GTGCAATGAGAGACTGATTCTGG + Intronic
1068211920 10:53931409-53931431 GTCCAATGCATGAGTGAGTCTGG - Intronic
1074544709 10:114393604-114393626 GTGGAATGGGAGAGTGAGTCAGG + Intronic
1076134708 10:128037333-128037355 GTGCAGTGAGTGAGTCATTCAGG - Intronic
1076795796 10:132798013-132798035 TTGCACTGGTTGAATAATTCTGG + Intergenic
1079274995 11:19027144-19027166 GTGCAAGAGTTGAGGCATTCGGG + Intergenic
1087582782 11:100079930-100079952 GTGCACTGCTGGAGTGCTTCTGG - Intronic
1090965245 11:131592439-131592461 GGGCAGTGCTTGAATGATTCTGG + Intronic
1092881117 12:12888553-12888575 GTGGAATAGCTGAGTGATTCTGG - Intergenic
1094296152 12:28907948-28907970 GTAAAATGGTTGAGTCATTTTGG + Intergenic
1096805247 12:54136778-54136800 AAGAAATGGTTCAGTGATTCAGG - Intergenic
1098462095 12:70743087-70743109 TGGCCATGGTTGGGTGATTCAGG + Intronic
1100533301 12:95480482-95480504 TAGCAATGGTTGAGAGTTTCAGG + Intronic
1101945722 12:109134916-109134938 GTGCCATGGTTGAGAAATCCTGG + Intronic
1102819601 12:115896464-115896486 GTGGAATGGTGGAGTGTTTGGGG - Intergenic
1107778132 13:43869564-43869586 ATACAATGGTTAAGTGATTTTGG + Intronic
1116419104 14:44712742-44712764 GTGAAATGGTTGGCTGCTTCCGG - Intergenic
1121306059 14:92907861-92907883 GTGGAATGGCTGAGTCATTTAGG + Intergenic
1121363495 14:93285206-93285228 GTGAAATGGATGAGTGAGTGGGG + Intronic
1122276925 14:100595692-100595714 GTGGAATGGTTGAGTTGTACGGG + Intergenic
1128604648 15:69027793-69027815 GCGCAAGGGATGAGTGAATCTGG - Intronic
1129074251 15:72977916-72977938 GTGCAGTTGTTGAGGGTTTCAGG - Intergenic
1132797367 16:1731820-1731842 GGGCAATGGTTTAGTGTTTGAGG + Intronic
1137789374 16:51162119-51162141 GTACAATGGCTGTGAGATTCTGG - Intergenic
1140654518 16:77125679-77125701 GTGCTATGGTGGCGTGATTTCGG - Intergenic
1141109274 16:81258603-81258625 GTGGAAGGGATGACTGATTCTGG + Intronic
1143019901 17:3911895-3911917 CTGCAATGATTGATTGGTTCTGG + Intronic
1145203682 17:20969173-20969195 GTGAAATGCCTGAGTGATGCTGG + Intergenic
1146044639 17:29493833-29493855 GAGTAATGGTTAAGTGATTTGGG + Intronic
1147130921 17:38408306-38408328 GTGCAGTGGTGGTGTGATCCTGG - Intergenic
1148806771 17:50267812-50267834 GAGCAGTGGGTGAGGGATTCAGG - Intergenic
1149852991 17:60052292-60052314 GTGGCTTGGCTGAGTGATTCTGG - Intronic
1151269618 17:72984078-72984100 CTGGAATCGTGGAGTGATTCTGG + Intronic
1153458196 18:5302272-5302294 GTGCAATGGTTCAGACATCCTGG - Intergenic
1156203768 18:34863698-34863720 ATTCAATGGTTGATTAATTCAGG + Intronic
1158085320 18:53644015-53644037 GTTCAATTGTTGAGTCATTAGGG - Intergenic
925335964 2:3099527-3099549 ATGCAATTGTTGAGGAATTCTGG - Intergenic
930367254 2:50455748-50455770 GTGCAATGATTGCATGAATCTGG + Intronic
931157747 2:59654485-59654507 GAGCAAGAGTGGAGTGATTCTGG + Intergenic
938107530 2:128543589-128543611 GGGCAATGGGTGAGGGAGTCGGG + Intergenic
938636790 2:133236319-133236341 GAGCAATGGTTCAGTGTTTAAGG + Intronic
939641471 2:144644730-144644752 GTGCATTAGTTGATTGTTTCTGG + Intergenic
945196438 2:207241438-207241460 GTGCCAGGTTTGAGTGATTTTGG - Intergenic
947507411 2:230719275-230719297 GTGCAATGTTTGTGTTATCCTGG - Intronic
1169699347 20:8428949-8428971 GTGGATTAGTTGTGTGATTCAGG + Intronic
1170415017 20:16130311-16130333 GTTCAATCATTGAGTTATTCTGG - Intergenic
949819889 3:8104723-8104745 TTGCAATGCCTGAGAGATTCAGG + Intergenic
950036204 3:9887647-9887669 GTGCAATTGCTGCGTGATCCTGG + Intergenic
951655272 3:25000182-25000204 GTGCAATGATTGAGAGATTCTGG + Intergenic
951785454 3:26413812-26413834 ATGCAATGGCTCAGTGTTTCAGG + Intergenic
959425907 3:106188138-106188160 GGGCAATTGTTGCATGATTCAGG + Intergenic
963165281 3:142195392-142195414 GTGCAGTGGTGGTGTGATCCTGG + Intronic
964195628 3:154061107-154061129 GTGCAATGGTTTTTTAATTCTGG - Intergenic
967073349 3:185981211-185981233 GTGCATTGGTTGTGTGAATTGGG + Intergenic
967515123 3:190359637-190359659 GTCCAATGGTTGAGTCAGACAGG + Intronic
970758853 4:19457899-19457921 GTGCAATGATTGATGGATTATGG - Intergenic
973214507 4:47654506-47654528 GTGCACTTGTGGAGTGATTGTGG + Intronic
973964781 4:56150872-56150894 GTGCAATTGTTGAGTCATGGGGG + Intergenic
975574527 4:75849619-75849641 CTGCAATGAGTGGGTGATTCAGG + Intergenic
975637065 4:76460940-76460962 GTGCAGTGGTGGTGTGATTATGG - Intronic
979530670 4:121766051-121766073 GAGCACTGGCTGGGTGATTCTGG + Intergenic
980761709 4:137242631-137242653 TTGCAATGATTGAGTGATGCAGG + Intergenic
982976032 4:162062352-162062374 GTGTACTTGTTGAGAGATTCAGG + Intronic
986292429 5:6411024-6411046 AAGCAAGGGTTGAGTTATTCAGG - Intergenic
990596627 5:57318677-57318699 TCTCAGTGGTTGAGTGATTCAGG - Intergenic
991039648 5:62162435-62162457 GTCCAATGTTTGTGTGAGTCTGG + Intergenic
992023616 5:72649596-72649618 GTGCAATGTGTGAGTCATTGTGG - Intergenic
993464790 5:88231764-88231786 GAGCAATGGTTCAGTGTTTGTGG - Intronic
993973233 5:94445041-94445063 GTCCAATGTCTTAGTGATTCAGG - Intronic
994475964 5:100270319-100270341 TTGAAATGGTTGAACGATTCAGG + Intergenic
994630774 5:102284645-102284667 GTTCAATGGTTGAATGAGTTTGG - Intronic
995737549 5:115318052-115318074 GTGAAATGGTTGAATGTTTATGG + Intergenic
996614270 5:125421604-125421626 GAGCAATGCTTGAGTGACTTGGG - Intergenic
999559066 5:152779809-152779831 GAGCAATGCATGTGTGATTCTGG - Intergenic
1001829697 5:174775314-174775336 ATGCTATGGTTGATTGAGTCAGG + Intergenic
1003597885 6:7490626-7490648 GTGCAAAGGCTGCGGGATTCTGG + Intergenic
1004589841 6:17039632-17039654 GTGGAATGGTGCAGTCATTCTGG - Intergenic
1004695825 6:18031868-18031890 GTGGAATTGCTGAGTCATTCAGG - Intergenic
1007172008 6:39870658-39870680 CTGCAATGGTTGAGGGCTACTGG - Intronic
1008444337 6:51570870-51570892 GTGCAGAGGTTGAGAAATTCTGG - Intergenic
1009712359 6:67341064-67341086 GTGCAGTGGTTGCGTGATCTCGG + Intergenic
1009946561 6:70347572-70347594 GTGCAATGGTGGAGGGGTTGTGG + Intergenic
1010262376 6:73831443-73831465 CTGCAAAGGTTGAGGAATTCTGG + Intergenic
1010495849 6:76533064-76533086 GTGCAATGGTAGAGAGCTTGTGG + Intergenic
1010657770 6:78532317-78532339 GTGCTAAGGTTGAGAAATTCAGG - Intergenic
1014291177 6:119560618-119560640 GTGCAATGGCTGAGTGAAAAAGG + Intergenic
1016581132 6:145630249-145630271 GTGCAATGGTTGAGTGATTCCGG - Intronic
1022248010 7:28579808-28579830 GTTCAATGGCTCAGTGATTCGGG - Intronic
1022298083 7:29075834-29075856 TTCCATTGGTTGAGTGACTCAGG + Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1026627121 7:72005016-72005038 CAGCAATGTATGAGTGATTCAGG - Intronic
1028077543 7:86534519-86534541 CTGCAATGGTGGAGGGATTGTGG + Intergenic
1033245511 7:139713928-139713950 GGGCAATGGTTGAGTGAATCTGG - Intronic
1036081545 8:5562053-5562075 GTGCAATGGATGAATGAATAAGG + Intergenic
1040633397 8:49242224-49242246 GTTCAACTGTTGTGTGATTCTGG - Intergenic
1041022700 8:53654320-53654342 GTGAAATGGTTAAGTGAAACTGG - Intergenic
1041498023 8:58508587-58508609 GTGAAATGGTCCAGTCATTCTGG - Intergenic
1043866079 8:85377358-85377380 TTGAAATGCTTGAGAGATTCAGG + Intronic
1046457750 8:114489682-114489704 ATGTAATGGTTGAGTGATCTTGG + Intergenic
1048639614 8:136339150-136339172 TTGTAATGGTGGAGTGATTTGGG + Intergenic
1048749208 8:137651676-137651698 TTGGAATGGTGGAGTGATTAAGG - Intergenic
1054910493 9:70450946-70450968 GGGCAGTGGCTGAGTCATTCAGG + Intergenic
1056326340 9:85481893-85481915 CAGCAATGGTTGAGTGTTTGGGG + Intergenic
1062650178 9:137571922-137571944 GGGCAATGATTGAATAATTCTGG - Intronic
1186255366 X:7712423-7712445 GTGAAATGGGTGAGTATTTCTGG + Intergenic
1186260864 X:7777890-7777912 GTGCAAAGGTTGAGAATTTCTGG - Intergenic
1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG + Intergenic
1196505038 X:116431972-116431994 GTGAAATGGTTAAGTGAATTTGG + Intergenic
1198403626 X:136291087-136291109 GGGCTTTGGTTGGGTGATTCAGG - Intergenic
1198765145 X:140072820-140072842 GTGAAATGGTAGAGTCACTCTGG + Intergenic
1201605058 Y:15774894-15774916 GTGGGATGGTTGAGAAATTCAGG + Intergenic