ID: 1016581349

View in Genome Browser
Species Human (GRCh38)
Location 6:145632113-145632135
Sequence GATAGTAATTTCCACCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016581349_1016581350 -4 Left 1016581349 6:145632113-145632135 CCTGTAAGGTGGAAATTACTATC 0: 1
1: 0
2: 2
3: 26
4: 214
Right 1016581350 6:145632132-145632154 TATCCTCATTTTCTTAATGCAGG 0: 1
1: 0
2: 0
3: 33
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016581349 Original CRISPR GATAGTAATTTCCACCTTAC AGG (reversed) Intronic
903093352 1:20944105-20944127 GAAAATAATTTCCAGCTCACTGG + Intronic
903527417 1:24002268-24002290 GATAGTAATTTATACCTAATAGG + Intergenic
904798414 1:33075006-33075028 GATAATAGTTCCCACCTTGCAGG + Intronic
905860708 1:41349340-41349362 AATAGTAGTTTCTACCTCACAGG - Intergenic
906309511 1:44743353-44743375 GATAATAATGTCTACCTCACAGG + Intronic
906566128 1:46802434-46802456 GATAATCATTTTTACCTTACTGG + Intronic
907087731 1:51692535-51692557 GATAGGAATTACAATCTTACAGG + Intronic
907827009 1:58027711-58027733 AATAATAATTTCTATCTTACAGG + Intronic
907847911 1:58226357-58226379 GATAGTAATGTCTACCTTTAAGG - Intronic
909257697 1:73445784-73445806 GATAGTAATACCCACCACACTGG - Intergenic
909375786 1:74940288-74940310 GATAGTAATATCTGCCATACAGG - Intergenic
909539793 1:76778587-76778609 GATAGTAATATCTACCTCACGGG - Intergenic
911042412 1:93601089-93601111 GATAATAACTCCCACCTTACAGG + Intronic
911753632 1:101527345-101527367 GATAATAATTGCCAGCTTAATGG + Intergenic
914337355 1:146727276-146727298 GATAGTGGTATCCACCTCACAGG - Intergenic
915029162 1:152861331-152861353 GGTAGGAATTTCCACCTGGCTGG - Intergenic
917652359 1:177090591-177090613 GATAATAAATTCCACCTAAATGG + Intronic
917739518 1:177948805-177948827 GATCGTAATTTCTACCTAACAGG + Intronic
917992385 1:180394944-180394966 GATGGTATTTTTCTCCTTACAGG - Intronic
919967459 1:202542315-202542337 GATAGCAATACCCACCTTTCAGG - Intronic
919994325 1:202734086-202734108 GATAATAGTGCCCACCTTACAGG + Intronic
920384243 1:205557060-205557082 GATAATAATATCTACCTCACAGG + Intergenic
921503008 1:215929698-215929720 GATGGTAATTCCCACCTGACTGG - Intronic
921845201 1:219871601-219871623 CATTGTAATCTCCACCTTCCAGG - Intronic
922055068 1:222034336-222034358 GAGAGTAAATTCCACCTACCAGG + Intergenic
923964538 1:239122657-239122679 AATAATAATTTCTACCTCACAGG + Intergenic
924121075 1:240798674-240798696 TATAATAATATCTACCTTACAGG + Intronic
1064114376 10:12565691-12565713 GATCATAATATCCACTTTACAGG - Intronic
1064610950 10:17101859-17101881 GATAATAATTTCTATCTTTCAGG + Intronic
1064954058 10:20887275-20887297 AATAGTAACTTCCACCTGATGGG + Intronic
1067181965 10:43994849-43994871 GATAGCAATTTCAACCCTTCAGG + Intergenic
1067716638 10:48695542-48695564 AATAGTAATGCCTACCTTACAGG + Intronic
1067956543 10:50797325-50797347 GATTATGATTTCCACCTTGCTGG - Intronic
1070641146 10:78170972-78170994 GATAATAATATCCACCTTGTAGG + Intergenic
1074945514 10:118277265-118277287 GATAGTAATACCTACCTCACAGG + Intergenic
1077637515 11:3854029-3854051 GATAGTGATTGCCACTTTTCAGG - Intergenic
1079098317 11:17525497-17525519 GATAATAATTCCCACATCACAGG - Intronic
1081838122 11:46174766-46174788 GATAATAATCGCCAACTTACTGG - Intergenic
1082246615 11:49930683-49930705 GATAGTATCTTCTACCTGACAGG + Intergenic
1083312770 11:61793210-61793232 GGTAATAAGTTCCACCTTATGGG + Intronic
1084077799 11:66795167-66795189 GATTGTAATACCTACCTTACAGG + Intronic
1085073295 11:73568298-73568320 GGTAGTAATTTACATATTACAGG - Intronic
1085703553 11:78766281-78766303 GATAATAATGCCCACCTTGCAGG - Intronic
1085742020 11:79085524-79085546 GATAGTATATACCACCTTACAGG + Intronic
1086147629 11:83570374-83570396 GATAGTCATTTGCAGTTTACAGG - Intronic
1086597578 11:88592248-88592270 GATAATAATATCTACCTTATAGG + Intronic
1087084218 11:94200001-94200023 GATGGAAATTTCCACATTGCAGG - Intergenic
1087893853 11:103565650-103565672 GATAATCATTTCCCTCTTACTGG + Intergenic
1089774413 11:120826443-120826465 GATAATAATATCCACCTCCCAGG + Intronic
1090564019 11:127966277-127966299 GGTAGCAATTTCCACCTCATAGG + Intergenic
1091818342 12:3456041-3456063 GATAGTAAGTCACACCTCACAGG + Intronic
1092603577 12:10094280-10094302 GATAATAATATCTACCTTATAGG - Intronic
1093304419 12:17495798-17495820 GGTAATAATATCTACCTTACAGG - Intergenic
1093549851 12:20395218-20395240 GATAATAAATTCTACCTTACAGG + Intronic
1096060957 12:48699915-48699937 GATTGTAAATTACACCTTACTGG + Intronic
1100336859 12:93639811-93639833 GATAGTAAGATCTACCTCACAGG + Intergenic
1100760172 12:97798557-97798579 TATAGTAGTTTCCACCTTAATGG + Intergenic
1102002016 12:109563335-109563357 GACATTAACTTCCACCTCACGGG + Intronic
1102141263 12:110617107-110617129 GATAGTAATTTTAAACATACAGG + Intronic
1102406960 12:112681598-112681620 GATAGTAGTGTCCACATTACAGG + Intronic
1104576186 12:129967933-129967955 GATAGTCACTTGCACATTACTGG + Intergenic
1106774003 13:32991048-32991070 GATAGTAATAGCAACCTTACAGG - Intergenic
1113194776 13:107789413-107789435 CATAAAAAGTTCCACCTTACAGG + Intronic
1115092309 14:29592706-29592728 GATGCTAATTCCTACCTTACTGG - Intronic
1117122531 14:52583728-52583750 AATAATAACTTCCACCTTCCTGG + Intronic
1120385855 14:83845009-83845031 GATAATAATTTCTACCTTCTTGG + Intergenic
1120931509 14:89853452-89853474 GATGGTAATATTCACCTCACAGG - Intronic
1121044093 14:90775334-90775356 AATAATAATATCTACCTTACAGG - Intronic
1121495137 14:94386909-94386931 GCTAATAATTTGCACCTTATAGG - Intronic
1122007805 14:98719678-98719700 GATAATAATACCCACCATACAGG - Intergenic
1125580846 15:40784494-40784516 GATAATAATTTCTACCTCATAGG - Intronic
1126393061 15:48179660-48179682 GATAGCAATACCGACCTTACAGG + Intergenic
1128207786 15:65868567-65868589 GATGGTAATTTCCATTTTAGCGG - Intronic
1128577332 15:68785088-68785110 AATAATTATTTCTACCTTACAGG - Intronic
1128586035 15:68850929-68850951 ATTAATAATATCCACCTTACAGG - Intronic
1129751471 15:78067808-78067830 GATGGTGATTCCCAGCTTACAGG + Intronic
1131488287 15:92840292-92840314 AATAGTAATGTCCACCTCCCAGG - Intergenic
1131667890 15:94589840-94589862 GATCCTAATTTTCACCTTTCTGG + Intergenic
1131700669 15:94932150-94932172 GATATTACTTTCCATTTTACAGG - Intergenic
1139199513 16:64959339-64959361 GATAGTAATTTTCTCCTTGTTGG + Intronic
1139282472 16:65782768-65782790 GAAAGAAATTTACACCTTCCTGG + Intergenic
1143273496 17:5693006-5693028 GTTAATAATTTCTACCTCACAGG + Intergenic
1143341120 17:6211886-6211908 AATGATAATATCCACCTTACAGG + Intergenic
1147552348 17:41452738-41452760 AATAATAATATCCACCTTAGAGG + Intergenic
1149356423 17:55844755-55844777 AATGGTAACTTCCACCTCACAGG + Intergenic
1150789836 17:68195281-68195303 GATAGTAACACCCACCTCACTGG - Intergenic
1151224983 17:72641104-72641126 GATAATAATATCTACCTCACGGG + Intergenic
1151355047 17:73553367-73553389 GATAATAACATCCACCTTCCAGG - Intronic
1153940742 18:9974328-9974350 GGTAGTAATTTCCATCTTCCTGG - Intergenic
1156213680 18:34975808-34975830 GATACTAATTTCCACCTCATAGG - Intergenic
1157270597 18:46272903-46272925 GATAATAGTTCCTACCTTACAGG + Intergenic
1159918565 18:74206985-74207007 TATAGAAAATTCCACCTTCCAGG + Intergenic
1162486696 19:10964919-10964941 GATAGAAAGTTCCACCAGACTGG - Intronic
1163093429 19:15037174-15037196 GATAGTAATATCCACTTTACTGG - Intergenic
926356216 2:12042963-12042985 GATAATGATTTCTACCTTGCAGG + Intergenic
927701620 2:25272720-25272742 GAAAGTAATTTCTGCCTTCCTGG + Intronic
928376948 2:30783068-30783090 GATAGTATTATCTACCTCACAGG + Intronic
928445583 2:31331077-31331099 GATAATCATATCCACCTCACTGG - Intergenic
928700103 2:33889852-33889874 GATAATAATATCTAACTTACAGG + Intergenic
939070060 2:137528384-137528406 GATAGTAATGACTACCTCACTGG + Intronic
939480379 2:142740858-142740880 CATAGTAATTTCAAGCTTATGGG + Intergenic
939638727 2:144613602-144613624 GATAATAATATTCACCTTACAGG + Intergenic
941770796 2:169343571-169343593 GTTAGTAATTTCTACCTTATAGG - Intronic
942516469 2:176758592-176758614 GATAATAATATTTACCTTACAGG + Intergenic
944175065 2:196819920-196819942 AATATTAATTTACACTTTACTGG - Intergenic
944683914 2:202101119-202101141 GATAATAATGTCAACCTTACAGG + Intronic
944994333 2:205276897-205276919 AATAATAATATCCACCTCACAGG + Intronic
945460252 2:210099751-210099773 GATTGTAATTTCCCCCTTCCTGG - Intronic
945876640 2:215284785-215284807 GATATTAATATCTACCTTTCAGG + Intergenic
945941905 2:215958927-215958949 GATACTAATACCCACCTCACAGG - Intronic
947446717 2:230169714-230169736 GTTGTTAATTTCCACCTGACAGG + Intronic
1169051606 20:2583278-2583300 GATAGTGATTTCCATCTTGCTGG + Intronic
1170310614 20:14987280-14987302 GATAGTAAAATCTACCTTATGGG + Intronic
1170449924 20:16472345-16472367 AATAATCATTTCCACCTCACTGG - Intronic
1171069588 20:22055022-22055044 AATAGTAATTACTACCTCACTGG + Intergenic
1171992940 20:31710362-31710384 GATAGTAATCTCTTCCTTATAGG - Intronic
1173848758 20:46204433-46204455 GATAGTAATACCTACCTCACAGG + Intronic
1176948731 21:15017547-15017569 GATAATAATAATCACCTTACAGG - Intronic
1182043489 22:27256721-27256743 AATATTAATTTCCACCTCATAGG + Intergenic
949352952 3:3144057-3144079 GATAGTAGTTTCTGCCATACAGG + Intronic
949513719 3:4788664-4788686 ACAAGTAATTTCCACCTGACTGG - Intronic
950436127 3:12981268-12981290 GATAGTAATATCTACCTTGTAGG + Intronic
952427342 3:33189002-33189024 GATAGTGATTTCCAACTTGTAGG + Intronic
956001138 3:64731204-64731226 GATAGTATTTTCAGCCTTGCAGG + Intergenic
959466202 3:106690715-106690737 GATACTATTTTCCACGTTTCTGG + Intergenic
959910633 3:111759699-111759721 GATAAAAATTTCCACCTTATAGG - Intronic
963941584 3:151101345-151101367 GATAATAATGACCACCTCACAGG - Intronic
964233493 3:154497595-154497617 GATATTTATTTCCAACTTAGAGG - Intergenic
964499422 3:157332015-157332037 AATAGTAATATGTACCTTACAGG + Intronic
964614734 3:158650577-158650599 GATTTTAATTTCAACCTTCCTGG - Intronic
964654159 3:159048273-159048295 AATAGTAGTATACACCTTACAGG - Intronic
965418323 3:168425456-168425478 GATAGAAATATGGACCTTACAGG + Intergenic
965657968 3:171009635-171009657 GATAATAATATCTACCTTATAGG - Intronic
966069628 3:175860119-175860141 AATAGTAAAATCCACCTTAAAGG + Intergenic
966701449 3:182857115-182857137 TATAATAATTTCCCCTTTACAGG + Intronic
967328746 3:188268897-188268919 CATAATAATTTCTACCTTATAGG - Intronic
968271379 3:197406149-197406171 GATAATAATCTCCTCCGTACTGG + Intergenic
968360523 3:198143775-198143797 GAAAGCAATTCCCACCTCACGGG + Intergenic
969234702 4:5857611-5857633 TATATTAATTTTCACTTTACAGG - Intronic
971036181 4:22695125-22695147 CATAATAATCTCCATCTTACAGG - Intergenic
971198124 4:24488655-24488677 GATGGTACTTTGCCCCTTACTGG + Intergenic
973246289 4:48014669-48014691 GGTAGTAGTATCTACCTTACAGG + Intronic
973740896 4:53918654-53918676 GGTAGCAATATCTACCTTACAGG - Intronic
974021772 4:56697863-56697885 GAGAGTGATATCCACCTTGCAGG + Intergenic
974131494 4:57761782-57761804 GATAATATTTTCCACATTACTGG - Intergenic
975188943 4:71437360-71437382 GATAGTAGTTTCTAATTTACTGG - Intronic
975238067 4:72024335-72024357 GGTAGAAATTTCTACATTACAGG - Intergenic
975569917 4:75804952-75804974 GATAGTATTTTCCAGATTTCTGG - Intronic
975697202 4:77024857-77024879 GATAGTAATGGCTACCTTATTGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976450542 4:85185512-85185534 AATAGTAATAACCTCCTTACTGG + Intergenic
977714220 4:100163133-100163155 GATAGTAATTTCCACCCTGCAGG + Intergenic
979224498 4:118268861-118268883 TAGATTAATTTCCACCTTCCTGG - Intergenic
981013313 4:139948813-139948835 GATGATAGTTTCTACCTTACAGG - Intronic
986647698 5:9934112-9934134 GATAATAATTCCTACCTCACAGG - Intergenic
987024480 5:13910564-13910586 GATAGACATTTGCACCTCACTGG + Intronic
988104715 5:26729897-26729919 TTTAATAATTTCCATCTTACTGG + Intergenic
988239133 5:28586445-28586467 ATTAGTAGTTTCCACCTTATGGG - Intergenic
988290873 5:29284370-29284392 GATAGTAATTTAGACTTTGCAGG - Intergenic
988845816 5:35126684-35126706 AATAGATATTTCCACTTTACAGG - Intronic
990750002 5:59004336-59004358 AATAATAGTTTCTACCTTACAGG + Intronic
991297620 5:65098659-65098681 GATAATAATCTCTACCTTTCAGG - Intergenic
992386944 5:76293814-76293836 GATGGGAATATCCACCTTCCTGG - Intronic
994491291 5:100447281-100447303 CATAGTGATTTCAACCTTAATGG + Intergenic
995175274 5:109168856-109168878 TATAGCAATTTCCAAATTACAGG - Intronic
996474080 5:123895329-123895351 GATACTACTTTCCAGCTTGCAGG - Intergenic
997195666 5:131977560-131977582 GAGAGTAATGCCCACCTCACAGG + Intronic
997250640 5:132386137-132386159 GATATTATTTTCCACCTTGCTGG - Intronic
997680617 5:135748132-135748154 TATTGTCATTTCCATCTTACAGG + Intergenic
998722463 5:144969561-144969583 GATAGTAATTCCAAACTTGCAGG - Intergenic
999018826 5:148140386-148140408 GCTAATAATTTCTACCTTACAGG + Intergenic
1001118576 5:168959902-168959924 GATAGTAGTTCCTACCTCACAGG - Intronic
1001171717 5:169425555-169425577 GATAGTAATATCTATCTTATAGG + Intergenic
1001555391 5:172633529-172633551 GACAGTAATATCTACCTCACAGG - Intergenic
1001579767 5:172790606-172790628 AATACTAATTTCTACCTCACTGG - Intergenic
1001649460 5:173305093-173305115 AATAACCATTTCCACCTTACTGG + Intergenic
1002650871 5:180692409-180692431 GATAGGAATTGAAACCTTACAGG - Intergenic
1003261365 6:4519266-4519288 GAGAGTAAATTCCACATTCCAGG + Intergenic
1003333780 6:5151759-5151781 GATAATAAAATCCACCTCACCGG + Intronic
1005489386 6:26332843-26332865 GATAATAATATCCACCTCATAGG + Intergenic
1007394212 6:41568299-41568321 AATAATAATATCCACCTTGCAGG - Intronic
1007461696 6:42024042-42024064 AATAATAGTATCCACCTTACAGG - Intronic
1008121838 6:47627324-47627346 GACAGTAATTTCTACTTTACAGG + Intergenic
1008299573 6:49818582-49818604 GGTAGTATTATCTACCTTACAGG + Intergenic
1009004180 6:57761899-57761921 TATAGTAAATTTCACCTTAAAGG - Intergenic
1010480633 6:76348539-76348561 AATAATAATTTCTACATTACAGG - Intergenic
1012376768 6:98571280-98571302 AATATTAATATCCACCTCACAGG - Intergenic
1012936366 6:105371953-105371975 GTTAGTTATTTCCACCTTCTGGG - Intronic
1013460711 6:110372582-110372604 GATTCTGCTTTCCACCTTACAGG + Intergenic
1013816536 6:114105028-114105050 GAGAGTAGTTTACACTTTACTGG - Intronic
1014147837 6:118018399-118018421 CATAATAATTCCTACCTTACAGG + Intronic
1015382486 6:132585694-132585716 GGTAATAATATCCACCTCACAGG + Intergenic
1016581349 6:145632113-145632135 GATAGTAATTTCCACCTTACAGG - Intronic
1017639031 6:156472324-156472346 GACATTAATTCCCACCTTACAGG + Intergenic
1022607410 7:31829275-31829297 GATAGTAATCTCTACCTCATAGG + Intronic
1023133776 7:37030602-37030624 GATAGTCATTACTACCTCACAGG + Intronic
1027305018 7:76885260-76885282 AATAGTAACATCCATCTTACAGG + Intergenic
1028165696 7:87536378-87536400 GAAACTAATTTTCTCCTTACGGG - Intronic
1028871650 7:95776884-95776906 GAGAAAAATGTCCACCTTACAGG - Intronic
1032022169 7:128413780-128413802 GATAGTATCTTCCACCTATCTGG - Intergenic
1032347510 7:131130457-131130479 GGTAGTAATATCTACCTTAGAGG - Intronic
1032960636 7:137029453-137029475 GATAATAGTGTCCACCTTATAGG - Intergenic
1033454039 7:141486439-141486461 CACAGTCATTTCCACCTCACTGG - Intergenic
1034340527 7:150351020-150351042 GATCGCAATCTCCACCTTCCAGG - Intergenic
1034750298 7:153562088-153562110 GAGTGTATTTTCCACCTTAACGG - Intergenic
1036510303 8:9393804-9393826 GATAATTATGCCCACCTTACAGG - Intergenic
1037079216 8:14762430-14762452 AATAATAATTCCCACTTTACAGG + Intronic
1038723383 8:30058165-30058187 GATAGTAAGTTCTGCCTTTCTGG - Intergenic
1043392582 8:79805912-79805934 GATAAAAATTCCCACCTCACAGG - Intergenic
1044436380 8:92168552-92168574 GGTAGTTATTTCTTCCTTACAGG - Intergenic
1045030153 8:98127460-98127482 AGTAGTAATAGCCACCTTACAGG + Intronic
1048018972 8:130520892-130520914 GATAGTAATTTCTACCTCAGTGG - Intergenic
1048020937 8:130538359-130538381 GAGAATAATATCTACCTTACAGG + Intergenic
1049895225 9:106353-106375 GATAGTACTGTCCATATTACTGG + Intergenic
1050649671 9:7762307-7762329 AATAATAATTTCCACCTCACAGG - Intergenic
1051684916 9:19648151-19648173 GATAATAATATCTACCTTAATGG - Intronic
1053738393 9:41116453-41116475 GATAGTACTGTCCATATTACTGG + Intergenic
1054689957 9:68314862-68314884 GATAGTACTGTCCATATTACTGG - Intergenic
1055129580 9:72759481-72759503 AATAGTCATATCTACCTTACTGG - Intronic
1055289309 9:74766579-74766601 AATAGTAATTCCTACCTTATAGG - Intronic
1058165096 9:101610207-101610229 GATAAAAATGTCTACCTTACAGG + Intronic
1058739566 9:107929758-107929780 GCGAGTAATTGCTACCTTACAGG - Intergenic
1060813465 9:126622934-126622956 GGTAGTAATTCCAATCTTACAGG + Intronic
1061055029 9:128218047-128218069 AAAAGTATTTTCCACCTTTCTGG + Intronic
1061635224 9:131903698-131903720 GATAATATTTGCCACCATACAGG - Intronic
1186904365 X:14095541-14095563 AATAATAATATCCACCTTGCAGG + Intergenic
1188253997 X:27936759-27936781 GATAGTGATGTCCATCTCACAGG + Intergenic
1188448880 X:30287870-30287892 GATAATAATACCCACCTTTCAGG + Intergenic
1190367229 X:49707281-49707303 GATAGAAAATTTCACTTTACAGG - Intergenic
1190553532 X:51610707-51610729 GATAATAAAATCCACCTTTCAGG + Intergenic
1192730247 X:73795781-73795803 CATTGTAATCTCCACCTTATGGG - Intergenic
1193419021 X:81261275-81261297 GATAATAATATCTACCTTGCTGG + Intronic
1193841746 X:86415777-86415799 TATTGTAATTTCCCTCTTACTGG - Intronic
1194511665 X:94803804-94803826 GACAGAAATTTTTACCTTACAGG + Intergenic
1195465578 X:105175218-105175240 GGGAGAAATTTACACCTTACAGG - Intronic
1196076233 X:111579617-111579639 GATAATAATCTCCATCTTTCAGG - Intergenic
1196102075 X:111857004-111857026 GATAATAATATCCACCTTGTAGG + Intronic
1197747885 X:129945055-129945077 AATAATAGTTTCCAACTTACAGG + Intergenic
1198035323 X:132796008-132796030 GATAGTATCCTCCACCTCACAGG + Intronic
1200167825 X:154049519-154049541 GATAGTATTTTCCACCTTGTGGG + Intronic
1200320953 X:155189166-155189188 CATATTAATCTCCATCTTACAGG - Intergenic
1201072203 Y:10157767-10157789 GATAGTAATCTCCTCCATTCAGG + Intergenic
1201544343 Y:15144246-15144268 GATAGTAATTTGTGACTTACAGG + Intergenic