ID: 1016582816

View in Genome Browser
Species Human (GRCh38)
Location 6:145648322-145648344
Sequence CTGCAGAACTAGACTGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016582816_1016582817 -2 Left 1016582816 6:145648322-145648344 CCTTGGTCAGTCTAGTTCTGCAG 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1016582817 6:145648343-145648365 AGCTGTGTTTGTCAATCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016582816 Original CRISPR CTGCAGAACTAGACTGACCA AGG (reversed) Intronic
903384657 1:22918457-22918479 CTCCAGGACTAGGGTGACCAGGG - Intergenic
904626712 1:31810218-31810240 CTGCATAACTTGACTGTTCACGG - Intronic
908003653 1:59706800-59706822 CTGTAGAATTAGATTGACAATGG + Intronic
908225079 1:62047622-62047644 TTGCAGAACTAGACACACTAAGG + Intronic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
914965561 1:152254404-152254426 CTTCAGAAGTTTACTGACCAGGG - Intergenic
921871798 1:220148810-220148832 ATGCAGAACTAGAGGGGCCAGGG - Exonic
923052485 1:230398588-230398610 CAGCAGAACTAGACAGAACTAGG + Intronic
923336112 1:232971611-232971633 GTGGTGAACGAGACTGACCAAGG + Intronic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
1076872892 10:133202256-133202278 CTGCAGAGCGAGGCTGCCCAAGG - Intronic
1077124581 11:926540-926562 CTCCAGTACTAGAAAGACCAAGG - Intronic
1079326038 11:19493565-19493587 CTGCAGAACTGGCCTCTCCAGGG - Intronic
1087512390 11:99114187-99114209 CTGCAGAGCTAGAAAGACAAAGG - Intronic
1087862132 11:103171792-103171814 CTTCAGAATTAGACAGACCTGGG - Intronic
1088729419 11:112667780-112667802 CTCCAGCATTAGACTGACCTGGG - Intergenic
1088826246 11:113496681-113496703 TTGCAGAAATAGACTGCACATGG + Intergenic
1090297204 11:125599290-125599312 TTTCAAAACTTGACTGACCAAGG + Intronic
1091338894 11:134795186-134795208 ATGCAGAACTTGACTGACCCGGG + Intergenic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1096905996 12:54936078-54936100 CTGAAGAACTAGACTCCTCAAGG + Intergenic
1098857982 12:75675389-75675411 CTCCAGAAATAGCCTGTCCATGG + Intergenic
1101345623 12:103883398-103883420 CTGCAGGGCCAGACAGACCAAGG + Intergenic
1102064142 12:109958877-109958899 CTACTGAACTAGACTCAACAGGG + Intronic
1103292770 12:119860664-119860686 CTGCACAAGGAGACAGACCACGG + Intronic
1105639060 13:22243909-22243931 GTGGAGAACTAGAGTGGCCATGG + Intergenic
1108146708 13:47484887-47484909 CAGCAGAACTAGACGCTCCAAGG + Intergenic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1111571033 13:90086795-90086817 CTGGAGAACTAGAAACACCAGGG - Intergenic
1112154622 13:96803918-96803940 CTGCAGAACCAGACAGACTGTGG + Intronic
1116067266 14:40000698-40000720 CTGCATAACTACAGTGAACATGG + Intergenic
1123689059 15:22822046-22822068 CTGCAGATATAGACTGACGTGGG + Intronic
1124952986 15:34340655-34340677 CTGCAGCACTAGGCCGGCCAAGG + Intergenic
1126924644 15:53570369-53570391 CTGGAGAACTAAACAGATCAAGG + Intronic
1128897078 15:71384671-71384693 CTCCAGAACTAGGCTCACCCGGG - Intronic
1130977472 15:88788486-88788508 CTGCAGAAGTAGCCTCCCCAGGG - Intergenic
1132344803 15:101101652-101101674 CTGCAGCACTGGACACACCACGG + Intergenic
1135392661 16:22106740-22106762 CTGCATAACTTGACTGCACAGGG + Intronic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1138677368 16:58661443-58661465 TTGCAGAACTAGAAGGAACAGGG - Intergenic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1141906232 16:87028809-87028831 CTGCAAAACCAGTCTGACTACGG + Intergenic
1144325308 17:14173675-14173697 CTCCAGAACAACACTGACCAAGG - Intronic
1144474180 17:15570561-15570583 CTCCAGAACAACACTGACCAAGG - Intronic
1147953093 17:44117842-44117864 CTGCAGAACTGGATAGACCCTGG + Intronic
1148994713 17:51699652-51699674 ATGCAGAACTGGACTGTCAAAGG - Intronic
1149316435 17:55443360-55443382 CTTCAGAAGGAGACTGATCAGGG - Intergenic
1155807587 18:30191974-30191996 TGGCAAAAATAGACTGACCATGG + Intergenic
1157175480 18:45448012-45448034 CTGCAAAACAAGACTGAGTATGG + Intronic
1161408214 19:4102242-4102264 CTGCAGAAAGAGAGTGGCCAAGG - Intronic
1164741298 19:30577577-30577599 CAGAAGAACTAGAATGACCCAGG - Intronic
1168075169 19:53977308-53977330 CTGCAGAACTGGACAGAGCTGGG + Intronic
1168078889 19:53994833-53994855 CTGCAGAAATAAAATGATCAAGG - Intronic
925815961 2:7749020-7749042 GTGCAGAGCAAGATTGACCAGGG + Intergenic
926982809 2:18589540-18589562 ATGCAAAGCTAGACTGAGCAAGG - Exonic
929029194 2:37635131-37635153 CTGCAGCACTTGACTCTCCAGGG - Intergenic
929512808 2:42578592-42578614 CTGCAGAGCTTCACTGTCCATGG + Intronic
934947607 2:98553144-98553166 CCGCAGAGCTGGACAGACCAAGG + Intronic
938615256 2:132991089-132991111 CTGTGGAATCAGACTGACCAGGG + Intronic
939441015 2:142249298-142249320 CTGCAGAACTACACAGAGGAGGG + Intergenic
940846688 2:158650099-158650121 CTGCAGAACAAGGGTGGCCAGGG + Intronic
943233114 2:185282959-185282981 GTGAAGAACATGACTGACCAGGG - Intergenic
945104162 2:206293106-206293128 CTGCAGAGTTAGAAAGACCATGG + Intronic
947496746 2:230643264-230643286 CTGCAGGACTAGAGTGGGCAGGG - Intergenic
948828853 2:240587580-240587602 CTGCTGAATAAGACTGCCCAGGG + Intronic
948927517 2:241108795-241108817 CTGCAGGACGAGACTGAACAGGG + Intronic
1175454658 20:59102958-59102980 CTGCAGTACAATATTGACCATGG + Intergenic
1180980625 22:19876502-19876524 CTGCAGAGCCAGGCTGACCGGGG - Intronic
1181648113 22:24244684-24244706 CAGCAGGACTAGGCTGACCGTGG + Exonic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183548372 22:38467525-38467547 CAGCAGAATCAGACTGACCTCGG - Intergenic
1184641003 22:45870056-45870078 CTGGAGAAAGAGACTGACAAAGG - Intergenic
949338061 3:2998402-2998424 CTGCAGAACCAGAATCTCCAGGG + Intronic
952690892 3:36204340-36204362 CTGCAGAATTGGACTGAGCATGG - Intergenic
954163851 3:48740503-48740525 CTGCAGAACTGCACTGAGCCAGG - Intergenic
955806399 3:62740078-62740100 CTGTTGACCTAGACTGAGCATGG + Intronic
961003767 3:123391101-123391123 CTGCCCAAACAGACTGACCAGGG + Intronic
964956045 3:162357066-162357088 CTCCAGAATTACACTGACTAGGG + Intergenic
966811256 3:183846998-183847020 CTGAAGTCCTAGAGTGACCAAGG - Intronic
966836822 3:184055815-184055837 ATGTAGAACTGGACTCACCATGG + Intronic
971178298 4:24302913-24302935 CTTCTGAAGTAGACTGACAATGG - Intergenic
973315948 4:48760138-48760160 CTTCAGAAATAGACTGATGAAGG - Intronic
973826008 4:54708346-54708368 ATGCAGGGATAGACTGACCAGGG + Intronic
974969925 4:68810275-68810297 CTGCTGAACTAAACTTACTAAGG + Intergenic
975211004 4:71699899-71699921 CTTCAGACCTAGACTTATCATGG + Intergenic
975350529 4:73340507-73340529 CTGCAAAACTACAGTAACCAAGG - Intergenic
975665928 4:76735110-76735132 CTGGAGAAGTAGCCAGACCATGG + Intronic
975931411 4:79528142-79528164 CTGAAGAACTAGACGCACAAAGG + Intergenic
977876457 4:102155854-102155876 CTACAGAACTATACATACCAAGG + Intergenic
979479206 4:121195791-121195813 TTTCAGAAATAAACTGACCAGGG + Intronic
985380195 4:189386082-189386104 CTGCAGAAAGAAACTGACTATGG - Intergenic
985773260 5:1826123-1826145 CAGGAGAACTAAACTGACCCAGG + Intergenic
987172274 5:15271121-15271143 CTGCAGAGCTAGAGTGAGAAAGG - Intergenic
989255923 5:39365579-39365601 CTGCAAAAATAGAATGACCTGGG + Intronic
1000431105 5:161153320-161153342 ATGCAGAACTAGCCTGATGAAGG + Intergenic
1002533752 5:179864769-179864791 CTGGAGCACCAGCCTGACCATGG - Intronic
1004440373 6:15644358-15644380 CAGCAGCACTAGACAGATCATGG + Intronic
1006485649 6:34339005-34339027 TTGCAGAACTGGACTGCCAAGGG + Intronic
1006602344 6:35234358-35234380 CTGAGGAACTAGACTTTCCAGGG + Intronic
1006880554 6:37335329-37335351 CTGCCGAACCAAACTGAACAGGG - Intergenic
1008977582 6:57446009-57446031 CTACAGAACTAGAAAGACCATGG - Intronic
1009165723 6:60338963-60338985 CTACAGAACTAGAAAGACCATGG - Intergenic
1009619263 6:66051585-66051607 GTGCAGAACTAGACTAAGTAAGG - Intergenic
1012375281 6:98554745-98554767 CTGCAGAACTAAATTGATAAAGG + Intergenic
1016582816 6:145648322-145648344 CTGCAGAACTAGACTGACCAAGG - Intronic
1018412550 6:163566791-163566813 CTGCAGAACTAAACTAACCTCGG - Exonic
1019403521 7:869719-869741 ATACAGTACTACACTGACCAAGG + Intronic
1019881742 7:3867190-3867212 CTTCAGAACAAAACTGGCCAAGG - Intronic
1024107764 7:46110129-46110151 CTGCAGAGCAAGACTGGTCAGGG - Intergenic
1024717286 7:52093774-52093796 CATCAGAACCAGACTGACCAGGG + Intergenic
1032325242 7:130921934-130921956 CTGATGAACTAGACTTCCCAGGG + Intergenic
1034035057 7:147811035-147811057 CTGGAGAACAAGACTAACTAAGG - Intronic
1034683841 7:152952305-152952327 GTGCAGAACTGGACAGAACAAGG - Intergenic
1038669007 8:29566493-29566515 CTGCAGAACTGCACTGCCAAGGG + Intergenic
1042041023 8:64588740-64588762 CTGCAGAAATAGACTGCACATGG - Intronic
1046309003 8:112409678-112409700 CTTCAGAACTGTACTTACCATGG - Intronic
1048244026 8:132774391-132774413 CTACTGAGCTAGACTGAGCATGG - Intergenic
1050045318 9:1537729-1537751 CTGCAAAGCTAGAATCACCATGG - Intergenic
1055007265 9:71522492-71522514 ATGCATAATTAGACTGGCCAAGG - Intergenic
1055129089 9:72753996-72754018 GTGCAGAGCTTGACTGAACAAGG - Intronic
1057605129 9:96493543-96493565 GTGCAAAACTAGACTGGGCATGG + Intronic
1061022042 9:128022290-128022312 CGGCAGCACTGGACTCACCAAGG - Intergenic
1061641713 9:131963219-131963241 CTGTAGAAATTGACTGGCCATGG - Intronic
1186398033 X:9230133-9230155 CTCCGGATCTAGAATGACCAAGG + Intergenic
1186738309 X:12490148-12490170 ATGCAGTACGAGACTGACCATGG + Intronic
1187897560 X:23997086-23997108 CTTCAGAAGTAAAGTGACCAGGG + Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1195293001 X:103447121-103447143 ATGCAGGACTAGCCTGAGCATGG + Intergenic
1196491587 X:116273706-116273728 CATCAGAGCTAGACTGACCTTGG + Intergenic
1196586881 X:117440183-117440205 CTGCTGCACTAGAGGGACCAAGG - Intergenic