ID: 1016584760

View in Genome Browser
Species Human (GRCh38)
Location 6:145672292-145672314
Sequence GTTTTAAAGGGATTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 395}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016584760_1016584770 11 Left 1016584760 6:145672292-145672314 CCTTCCCCAAATCCCTTTAAAAC 0: 1
1: 0
2: 1
3: 45
4: 395
Right 1016584770 6:145672326-145672348 AGGTCACAGAAATGAAAAGACGG 0: 1
1: 0
2: 6
3: 93
4: 793
1016584760_1016584766 -9 Left 1016584760 6:145672292-145672314 CCTTCCCCAAATCCCTTTAAAAC 0: 1
1: 0
2: 1
3: 45
4: 395
Right 1016584766 6:145672306-145672328 CTTTAAAACACACGCCCCTAAGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016584760 Original CRISPR GTTTTAAAGGGATTTGGGGA AGG (reversed) Intronic
901067900 1:6503114-6503136 GTTTTAAAGAGCTTTGAGGCTGG + Intronic
901107244 1:6766100-6766122 GTTATAAAGGGGTTAGGGGTGGG - Intergenic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902978469 1:20106688-20106710 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
906047374 1:42842456-42842478 GGTCTTAAGGGATTTGGGGATGG - Intronic
907705316 1:56827580-56827602 ATTTAAAAGGGATCTGGGAATGG - Intergenic
908058352 1:60317657-60317679 TTTTTAAAAGGATTGGTGGAAGG - Intergenic
908896993 1:68911839-68911861 GTTTTAAGGGGATTTATGGAGGG - Intergenic
909261785 1:73499392-73499414 GTTTTAAAGGGATGATGGGGAGG - Intergenic
910378127 1:86595459-86595481 ATGTTAAAGGGATTTTGGAATGG - Intergenic
911382952 1:97138806-97138828 ATTTTCCAGGGATTTGGAGAAGG + Intronic
911440963 1:97925290-97925312 GTTTTGAATGGGTTGGGGGATGG - Intergenic
911883093 1:103266536-103266558 ATTTTAAAGGGCTTTAGGGAGGG - Intergenic
912002481 1:104852291-104852313 GTGTTAAGGAGTTTTGGGGAAGG + Intergenic
912079386 1:105915988-105916010 GTTTTAAAAGGAACGGGGGATGG - Intergenic
912678465 1:111709677-111709699 GTTTTAATTTAATTTGGGGAAGG - Intronic
912748614 1:112267033-112267055 ATTTTAGTGAGATTTGGGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
916822924 1:168417233-168417255 GTTAAAAAAGGATTTGAGGATGG + Intergenic
917686050 1:177416949-177416971 GTTTTCAGGGGGTTTGGAGATGG + Intergenic
918009852 1:180576698-180576720 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
918695793 1:187544823-187544845 GTTTGACAGTGGTTTGGGGATGG - Intergenic
918790309 1:188816915-188816937 TTTTTAAAGCTATTTAGGGAGGG - Intergenic
919762090 1:201104352-201104374 GTTTTCAAGGGATTGGGGAGGGG - Intronic
919994430 1:202735343-202735365 GTTTTATAGGAATTTGGAGAAGG - Intronic
920078434 1:203354051-203354073 GTTTTAAAGTGAGATGGGGCTGG + Intergenic
920314183 1:205065933-205065955 GGTTTTAAGGGAGTTGGGGTAGG - Intronic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921798452 1:219374887-219374909 GTTTTAAAGAGTTTTGGAGTGGG - Intergenic
922201831 1:223409932-223409954 GGCTTAAAGGGATTTGTGGTTGG + Intergenic
923369963 1:233299965-233299987 AGTTTAAAGGGATTAGGTGAGGG - Intergenic
923522245 1:234744339-234744361 GTTTTGTAGGGATGTGGGGAAGG + Intergenic
923863273 1:237913941-237913963 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
923928999 1:238671726-238671748 GTTGGAAAGGGTTGTGGGGAGGG + Intergenic
1063340787 10:5261568-5261590 GTTTGAAAGGAATTTGGGCCAGG + Intergenic
1063391248 10:5651132-5651154 GGATTAAAGGGACTTAGGGAAGG - Intronic
1063604526 10:7510611-7510633 GTATTTAAGGGCTTTAGGGAGGG + Intergenic
1064686713 10:17869146-17869168 GTTTTACAGGTACTTGGGGTAGG + Intronic
1064884449 10:20094226-20094248 GTTTGAAAGTAATTTGGGTATGG + Intronic
1064898719 10:20270068-20270090 GTTTAAAATGGTTGTGGGGAAGG + Intronic
1065207829 10:23374080-23374102 GTTTTCAAGGGGTTTGGAGTGGG - Intergenic
1067918853 10:50431789-50431811 GATTTGAAGGAATATGGGGAAGG + Intronic
1069250624 10:66261905-66261927 GTTTTTAAGGGTTTTGGAGTGGG - Intronic
1069411914 10:68162822-68162844 GTTTTTAAGGGTTTTGGAGTGGG + Intronic
1069801700 10:71085807-71085829 CGTTTAAAGGGATTAGGGGTTGG - Intergenic
1070848929 10:79546794-79546816 ATTTTATTAGGATTTGGGGAGGG + Intergenic
1070924863 10:80213396-80213418 ATTTTATTAGGATTTGGGGAGGG - Intergenic
1070944393 10:80376862-80376884 GTTTTGAAGGGATCTGGCAATGG - Intergenic
1071371897 10:84959927-84959949 GTTTTTAAGGGGTTTGGAGTGGG - Intergenic
1072818437 10:98532338-98532360 GCTATAAAGGGAGTTGGGAATGG + Intronic
1074591568 10:114818630-114818652 ATTTTAGCGGGATTTGAGGAGGG + Intergenic
1075612832 10:123867094-123867116 TTTAAAATGGGATTTGGGGAAGG - Intronic
1078251186 11:9617746-9617768 GTTTTAATAGGATTTGTTGATGG + Intergenic
1078529006 11:12121913-12121935 GTATTGATGGGATTTGGGGTGGG + Intronic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1079364615 11:19798469-19798491 GCTTTAAAAAGATGTGGGGAGGG + Intronic
1079763085 11:24355756-24355778 CTTTTAAAGGGTCTTGGAGATGG - Intergenic
1080438844 11:32271682-32271704 TTTATAAATGGCTTTGGGGAAGG - Intergenic
1080597652 11:33788880-33788902 GATTTCATGGGACTTGGGGAAGG - Intergenic
1080679867 11:34464468-34464490 TTATTGAAGGGATATGGGGAGGG + Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081303422 11:41482371-41482393 GTTTTTAATTTATTTGGGGATGG + Intergenic
1081560005 11:44204882-44204904 ATTTTATAAGGATTTGGGAATGG + Intronic
1081643883 11:44776886-44776908 GTTTTAAAGGGATTGGGTTTGGG + Intronic
1085441705 11:76569989-76570011 GTTTGCCAGGGGTTTGGGGAAGG - Intergenic
1085558372 11:77446750-77446772 ATTTTAGAGTGATTTTGGGAGGG - Intronic
1085731281 11:79001478-79001500 GTGTTCATGGGATTTGGGGGGGG - Intronic
1086994113 11:93336912-93336934 GTGTTAGTAGGATTTGGGGAGGG + Intronic
1088330345 11:108644503-108644525 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1088993179 11:114972316-114972338 GAAATAAAGGAATTTGGGGATGG - Intergenic
1090359814 11:126164461-126164483 GTCTTAAAAGGATTTGGTGCTGG - Intergenic
1090945881 11:131429164-131429186 ATTTTTAAGGGATTGAGGGATGG + Intronic
1093843479 12:23936250-23936272 GTTTTAAAGAAGTTTGTGGAGGG - Intronic
1094667918 12:32539727-32539749 ATTTTAACTGCATTTGGGGAAGG - Intronic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1097074727 12:56384422-56384444 GTTTTAACAGGATTTTTGGAGGG - Intergenic
1097176173 12:57144507-57144529 GTTTTAGAGGGGTCGGGGGACGG - Intronic
1097381492 12:58900451-58900473 ATTTTAAAGGGATTTTAGGAAGG + Intronic
1097952830 12:65451585-65451607 ATTTTACAGGGTTTTGGGGGTGG - Intronic
1098045705 12:66398220-66398242 GTTTTAAAGATATTCTGGGAAGG - Intronic
1098984558 12:76997828-76997850 CTTTTAAGGAGATTTGGGGATGG - Intergenic
1099480191 12:83156410-83156432 ATTTTGAAGGGATATTGGGATGG + Intergenic
1099562026 12:84191075-84191097 GGTTGGAAGGGATATGGGGAGGG - Intergenic
1100031153 12:90193034-90193056 GTTGTAAAAGAATTTGAGGAGGG - Intergenic
1100705265 12:97193967-97193989 ATTTTTAAGGGTTTTGGAGAGGG + Intergenic
1100729051 12:97443588-97443610 GTTAGGAAAGGATTTGGGGAAGG - Intergenic
1100843107 12:98632976-98632998 GAGTGTAAGGGATTTGGGGAAGG - Intronic
1101971796 12:109319688-109319710 GTGTTAAAGACATTTGGGGCTGG + Intergenic
1102010913 12:109617841-109617863 GTTTTAATGGGGTGTTGGGAGGG + Intergenic
1102016833 12:109653652-109653674 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1102409329 12:112703759-112703781 GTTTTTAAAGGTTTTGGGGTGGG - Intronic
1102811708 12:115829907-115829929 GTTTGCCAGGGACTTGGGGAGGG - Intergenic
1104270774 12:127280666-127280688 GATTTAATTGGATATGGGGATGG + Intergenic
1104685679 12:130782650-130782672 GTTTCAGAGGGAGCTGGGGACGG - Intergenic
1104879135 12:132057598-132057620 GTTTTAGAGGGATTTATTGAAGG - Intronic
1106289629 13:28348611-28348633 GTTTTAAAGAGTTTAGGGGCCGG + Intronic
1106471697 13:30061681-30061703 GTGTTAAAAGCATTTAGGGAGGG - Intergenic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1107256723 13:38436278-38436300 GTTATCAAGAGTTTTGGGGAGGG - Intergenic
1107330163 13:39291087-39291109 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
1108253511 13:48589477-48589499 GTTTTTAAGGGTTTTGGAGGGGG + Intergenic
1108446651 13:50515821-50515843 TTAGTAAAGGGATTTTGGGAGGG - Intronic
1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
1109966525 13:69705586-69705608 TTTTTAAAGGGATTTTGTGTGGG + Intronic
1110086204 13:71383849-71383871 GGTTTCCAGGGACTTGGGGAGGG - Intergenic
1111628534 13:90819724-90819746 GTTTTAAAGTGAATTTTGGAAGG + Intergenic
1112020827 13:95369636-95369658 GTTTTTAAGGGTTTTAGGGTGGG + Intergenic
1112247703 13:97749512-97749534 GTTTTCAAGGGTTTTGGAGCAGG + Intergenic
1112295283 13:98180746-98180768 ATTTTAGTGGGATTTTGGGAGGG + Intronic
1113093420 13:106638119-106638141 CTTATTAAGGGATTTGGGAAAGG - Intergenic
1113675499 13:112204144-112204166 GTTTTAAAGGAAGTTGAAGAAGG - Intergenic
1114242242 14:20878990-20879012 GTTTTACAGAGTTTTGGGAAAGG + Intergenic
1115041323 14:28932651-28932673 GTTTTAAGGGGATTCAGGGTTGG - Intergenic
1116244341 14:42389901-42389923 GTTATAATGGGAGTTGAGGAAGG + Intergenic
1116360692 14:43993100-43993122 TTTTTAAAGCAATTTGGGGAAGG - Intergenic
1116394127 14:44428400-44428422 GGTTTAGAGGGAGTTGGGTAGGG - Intergenic
1116838974 14:49799927-49799949 CTTTCATAGGGATTTGGTGAAGG - Intronic
1117031400 14:51674702-51674724 TTTTTAAAGGGTGTGGGGGAAGG - Intronic
1117079216 14:52134014-52134036 ATTTTACAGGGATTTGGGGTAGG + Intergenic
1117216932 14:53560793-53560815 GTGACAAAGAGATTTGGGGAAGG + Intergenic
1117221534 14:53611419-53611441 GTTCTAAAAGGATTTGAGGCTGG + Intergenic
1117406663 14:55411152-55411174 GCTTTAGAGGGATTTGGGCCTGG - Intronic
1117421686 14:55552793-55552815 GTTTTCAGGGGCTATGGGGAGGG + Intergenic
1118914553 14:70091919-70091941 GTTTTAGAGGATTTGGGGGAAGG - Intronic
1120833808 14:89022369-89022391 GTTTTAAAAGAATATTGGGATGG - Intergenic
1120957297 14:90093949-90093971 GTTTTAATGGGATTTGCAGGGGG + Intronic
1122330137 14:100906392-100906414 GTTTAAAGGGGATTTGGGCAGGG + Intergenic
1124189539 15:27562632-27562654 GTTTTACAGGAACTGGGGGATGG + Intergenic
1125067591 15:35508584-35508606 TTTTTAAAGTGTTTTGGGGTAGG - Intronic
1127337731 15:58006183-58006205 GTTATAATGGACTTTGGGGAAGG - Intronic
1127690518 15:61391563-61391585 GTTTTAGTGGGATTTTAGGAAGG - Intergenic
1128464595 15:67899494-67899516 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1130015581 15:80183646-80183668 GTTAGAAATTGATTTGGGGAAGG - Intronic
1131998260 15:98154419-98154441 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
1133129049 16:3664891-3664913 GTTTCAGTGGGATTTGGAGAAGG + Exonic
1134855377 16:17514378-17514400 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1135915200 16:26599365-26599387 GTTTTTAAGGGTTTTGGAGTAGG + Intergenic
1135947900 16:26881440-26881462 GTTTTTTAATGATTTGGGGAGGG + Intergenic
1136048627 16:27634940-27634962 GTTTTTAAGGGTTTTGGAGTAGG + Intronic
1137641589 16:50035884-50035906 GTTTTAAAGAGCTGTGGGGATGG - Exonic
1139132358 16:64161777-64161799 GCTTTAAAATGATTTGGTGAAGG + Intergenic
1139283004 16:65785806-65785828 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1140122525 16:72096024-72096046 GTCTTAAGGGGAGATGGGGAAGG + Intronic
1140630672 16:76848373-76848395 GTTTCCTAGGGATTTGGGGGGGG - Intergenic
1141585848 16:85033064-85033086 GTTTTAAAGGGATTGGCAGGAGG + Intronic
1141677847 16:85527020-85527042 GTGGTGCAGGGATTTGGGGAGGG + Intergenic
1143317084 17:6040986-6041008 GTGCTAAAGGGGTGTGGGGAAGG - Intronic
1143396300 17:6600832-6600854 GTTTTAGTGGGATTTGGAGAGGG - Intronic
1143606134 17:7987337-7987359 ATTTTAGTGGGGTTTGGGGAGGG + Intergenic
1143875757 17:9989559-9989581 TTTCTAATGGGATTGGGGGAGGG + Intronic
1143916596 17:10298109-10298131 GTGTCAAAGGCATTTGGGGTGGG + Exonic
1144526363 17:15993913-15993935 GTTTTAGTGGGGTTTGGGGAAGG - Intronic
1144528398 17:16011503-16011525 ATTTTAGTGGTATTTGGGGAAGG + Intronic
1145124741 17:20291020-20291042 GTGTTAAAGTGAATTTGGGAAGG + Intronic
1146012850 17:29209443-29209465 GTGTTCTAGGGCTTTGGGGAGGG - Intergenic
1147702091 17:42402722-42402744 TGTTTTAAGGGATTGGGGGAGGG - Exonic
1149702863 17:58669870-58669892 GTATTGAAGGGCTTTGGGCAAGG - Intronic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150985379 17:70190724-70190746 ATTTTTAAGGAACTTGGGGAAGG - Intergenic
1151272310 17:73006427-73006449 TTTTTAAAGGGTCTTGGAGAAGG + Intronic
1153205007 18:2689717-2689739 ATTTTAAAGTGATTTTGGGCTGG + Intronic
1153309072 18:3660177-3660199 TTTTTAAAAGGATTGGGGGTGGG + Intronic
1154048732 18:10932975-10932997 GTTGCAAAGGGACTTAGGGAAGG + Intronic
1155313974 18:24552787-24552809 TTTTTAAAGAGATTACGGGAAGG + Intergenic
1155426491 18:25712898-25712920 GTTATAAAGAGATATGGAGAAGG - Intergenic
1155569483 18:27176041-27176063 GTTTTTAGGGGATGGGGGGATGG + Intronic
1155712462 18:28899804-28899826 ATTATAAAGGGATATAGGGAAGG - Intergenic
1156561038 18:38125915-38125937 GTTGTAAAGGTATTAGAGGAGGG + Intergenic
1157741356 18:50096298-50096320 ATGTTGAAAGGATTTGGGGATGG - Intronic
1158211584 18:55056322-55056344 GCTTCAAAGGGAGTTGGGAAAGG - Intergenic
1159565277 18:70041342-70041364 ATTTTAATGGGATTTCAGGAGGG - Intronic
1160524445 18:79526711-79526733 GTTGAAAGGGAATTTGGGGAAGG + Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162246797 19:9407745-9407767 ATTTAAAAGTGATTTGGGGCGGG + Intergenic
1163809785 19:19423711-19423733 GTTGTAGAGGGGGTTGGGGATGG + Intronic
1165145884 19:33729778-33729800 GTTTTTAAGGGTTTTGGAGTGGG + Intronic
1165948081 19:39457417-39457439 TTTTAAAAGGGATTTGGGAGTGG + Intronic
1166017735 19:39995673-39995695 ATTTTTAAGGGATTTGGGGGGGG + Intronic
1166302167 19:41917481-41917503 GTGTTAAGGGGAGGTGGGGATGG - Intronic
1166441188 19:42816666-42816688 GTTGTCAAGAGATTTGGAGAGGG - Intronic
1166477960 19:43145246-43145268 GTTGTCAAGAGATTTGGAGAGGG - Intronic
1166581970 19:43909037-43909059 GTTTTAAAGGCTTTTGTGTAGGG - Intergenic
1166720859 19:44994945-44994967 GTGTGAATGGGATGTGGGGAGGG - Intergenic
1168289067 19:55348150-55348172 GTTTTGAAGGGATGTGAGGAGGG + Intergenic
924985828 2:268734-268756 TTTTTAAAGGCATTTGAAGATGG + Intronic
925343999 2:3157116-3157138 GTCTTAAAGGGACCTGAGGAGGG + Intergenic
925445087 2:3920545-3920567 GCATTAAAGGGATGTGTGGATGG + Intergenic
925556788 2:5139870-5139892 GTTGGAAGGGGAGTTGGGGAGGG + Intergenic
925669745 2:6298184-6298206 GTTACAAGGGGTTTTGGGGAAGG + Intergenic
925719367 2:6812852-6812874 ATTTTAATGGGATTTTAGGAGGG - Intergenic
926608480 2:14921909-14921931 GTTTGAAAAGGGTGTGGGGATGG - Intergenic
927487349 2:23497588-23497610 GTTTTGTAGGGATTTAGGGAAGG + Intronic
927769369 2:25845711-25845733 GTAGTGAAGGGATGTGGGGATGG - Intronic
927859050 2:26548489-26548511 GTTGTCAAGGGCTGTGGGGAGGG - Intronic
927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
929507942 2:42542989-42543011 GTTTTTAAGAGTTTTGGGGTAGG + Intronic
930099549 2:47592232-47592254 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
930233023 2:48861689-48861711 GTTTTAAAGAAAGTTGGGAAAGG - Intergenic
931148173 2:59542835-59542857 ATGTTAAAGGTATATGGGGAAGG - Intergenic
931473593 2:62565005-62565027 GTTCTAAATGGAGGTGGGGAGGG + Intergenic
932017631 2:68048783-68048805 ATATTGTAGGGATTTGGGGAGGG - Intronic
932480236 2:72034809-72034831 GTGTTAAACGGATTTGATGAGGG - Intergenic
932533594 2:72566026-72566048 GTTTTAAAGTGTTTTGCGTATGG + Intronic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934798337 2:97123394-97123416 GTTTTTAATTGATATGGGGAGGG + Intronic
934835092 2:97580036-97580058 GTTTTTAATTGATATGGGGAGGG - Intronic
934990663 2:98918771-98918793 GTTTTAATGGGATTTTGTGTGGG + Intronic
935321451 2:101893402-101893424 CCTTTAAAGGGATTTGAGGTAGG + Intronic
935454475 2:103251261-103251283 GGGTTAAAGGGATGGGGGGATGG - Intergenic
936551180 2:113441416-113441438 ATTTTAAATGAATTTGGGGAAGG + Exonic
936654050 2:114463806-114463828 GATTTGAAGGGGTTTGGGGAGGG - Intronic
936707356 2:115090438-115090460 TTTTGTCAGGGATTTGGGGAGGG + Intronic
937887268 2:126908496-126908518 GTTTTAATGGAATTTCAGGAGGG - Intergenic
938422301 2:131155024-131155046 TTTGGAAAGCGATTTGGGGATGG + Intronic
938729276 2:134133748-134133770 GTTTTTAAGGGTTTTGGAAAGGG + Intronic
938868333 2:135447838-135447860 GTTTTAATGAGATTTTGAGAGGG + Intronic
940341743 2:152588702-152588724 GTTTTAAAGAGCTTAGGGCATGG + Intronic
941113695 2:161447091-161447113 ATTTTAGAGGGATTTGGAGAAGG + Intronic
941123140 2:161554528-161554550 GTGTGAAAGTGATTTAGGGAAGG + Intronic
941474666 2:165935490-165935512 GTTTTAAAATGATTAGGGAAAGG + Intronic
942220446 2:173763628-173763650 CTTTTAAAGGGAGTTGGGTGGGG - Intergenic
942809441 2:179980235-179980257 GTTGAAAAGGAATTTGGAGATGG - Intronic
943078794 2:183231418-183231440 ATTTCAAAGGGATTTTGGAAGGG + Intergenic
943288405 2:186035086-186035108 GTTTTAATGGCCTTTGGGCAAGG + Intergenic
943294297 2:186117376-186117398 TTTTTAAGGGGATTTGTGGAGGG - Intergenic
945981743 2:216317708-216317730 GCTTTAAAAGGATTAGGGGCTGG - Intronic
946418064 2:219550445-219550467 GTTGGGAAGGGAGTTGGGGAGGG + Exonic
947710669 2:232313664-232313686 GATATAAAGAGATTTGGGGTAGG - Intronic
948049758 2:234970996-234971018 TTTTTAAAGGCAGTGGGGGAAGG - Intronic
1169438430 20:5613702-5613724 ATTTCAAAAGGATTTAGGGAAGG - Intergenic
1169514090 20:6297475-6297497 GTTGTCAAGGGGTTGGGGGAAGG - Intergenic
1170620686 20:17993373-17993395 GCTTTAAAAGGAATTGGAGAAGG + Intronic
1170819112 20:19740895-19740917 CATTCTAAGGGATTTGGGGAGGG - Intergenic
1170848939 20:19986309-19986331 GTTTATTAAGGATTTGGGGAGGG + Intronic
1171440998 20:25162896-25162918 GTTTTCATGGGCTGTGGGGAGGG - Intergenic
1172232910 20:33349053-33349075 CATCTAAAGGGATTTGGGCATGG - Intergenic
1172411104 20:34723697-34723719 TTTTTAAGGGGTGTTGGGGATGG - Intronic
1174094606 20:48078316-48078338 TTGTTAAAGGTGTTTGGGGAAGG + Intergenic
1174855717 20:54043354-54043376 TTTTTAGAGGGATTTGAGGTAGG + Intronic
1175006755 20:55691587-55691609 GAATTAAAGCCATTTGGGGAGGG - Intergenic
1177052032 21:16248368-16248390 GTTTTAAAGGAATTTAGGCTGGG - Intergenic
1177692138 21:24524601-24524623 GTTTTAGAGGGTTTTTTGGAAGG - Intergenic
1179599264 21:42465123-42465145 GTTTTTAAGGGTTTTGGCGTAGG + Intergenic
1181968541 22:26673070-26673092 GTTGAAAAGGGGTGTGGGGAGGG + Intergenic
1182055267 22:27348224-27348246 GATCGAAAGGGATTTGTGGAAGG - Intergenic
1182679673 22:32068857-32068879 GATTAAAAGGGAGTTAGGGATGG + Intronic
1182961791 22:34482194-34482216 GTTGTCAGAGGATTTGGGGAGGG + Intergenic
1183698742 22:39437998-39438020 GTTTTAAGGGGGTTTGAGAAGGG - Intergenic
949381571 3:3451993-3452015 CTTTTAAAGTGATATGGGCAGGG - Intergenic
949981399 3:9504019-9504041 TTTTTTAAGAGATTGGGGGAGGG - Intronic
951090594 3:18569129-18569151 GTTTCAGAGGGATTTCAGGAAGG - Intergenic
951697248 3:25458001-25458023 GTTTGAGAGGCATCTGGGGAAGG + Intronic
951700447 3:25491279-25491301 GTGTAAAAGGGACTTGGGGGTGG - Intronic
952249524 3:31637853-31637875 TTTTGGAAGGGATTTGGGGAGGG + Intergenic
953637839 3:44677726-44677748 GATTTACAGAGGTTTGGGGAGGG + Intergenic
954241278 3:49295740-49295762 GTTTGCTAGGCATTTGGGGAGGG - Intronic
955210512 3:56936110-56936132 TTTTCTTAGGGATTTGGGGATGG + Intronic
955560477 3:60183695-60183717 GTTTTAAAGGGATTCTGGGGAGG - Intronic
956201996 3:66716161-66716183 GTTTTAGAGGCTTTTGTGGAAGG - Intergenic
956461210 3:69474444-69474466 GTTCCAAGGGGAATTGGGGATGG + Intronic
957513350 3:81218674-81218696 GTTTTAATCAGATTTGGGAAAGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958134608 3:89472231-89472253 GATTTAAAAGCATTTGTGGATGG + Intronic
958566525 3:95818608-95818630 ATTTTAAATTGATTTGGGGGGGG + Intergenic
958600704 3:96293267-96293289 TTTTTAATGGGATTTGTGAAGGG + Intergenic
961960016 3:130845154-130845176 GTTTTTGATGGATTTGGGGCAGG - Intergenic
963243496 3:143035009-143035031 GTTTTAAATGGGTGGGGGGAGGG + Intronic
964036660 3:152207385-152207407 GTTTTCAAAGGATCTGGGTAGGG - Intergenic
964093704 3:152906628-152906650 TTTTCAAAGGGATTAGGTGAAGG + Intergenic
965970355 3:174546967-174546989 ATTTTAGTTGGATTTGGGGATGG + Intronic
966121138 3:176521893-176521915 CTTTTAAGGGGATTTGTGGAGGG + Intergenic
966130315 3:176630156-176630178 TTTTTCAATGGTTTTGGGGAAGG - Intergenic
967864556 3:194179548-194179570 GATGTGAAGGGATGTGGGGAAGG - Intergenic
970420830 4:15904533-15904555 GTTTCAATAGGATTTGGAGATGG - Intergenic
970593014 4:17576063-17576085 GTTTTTAAGGGTTTTGGAGAGGG - Intergenic
971272332 4:25161566-25161588 TTTTTAAGGGGATTTGTGGAGGG - Intronic
971318129 4:25584245-25584267 GTTTCAAAGTGATTTATGGAGGG - Intergenic
971482055 4:27123811-27123833 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
972412755 4:38809558-38809580 GTTCTAAATTGATTTGGTGATGG - Intronic
973807876 4:54543017-54543039 ATTCTTCAGGGATTTGGGGATGG + Intergenic
973822789 4:54677420-54677442 GTATTTCAGGGATATGGGGAAGG + Intronic
973851358 4:54964555-54964577 CTGTTACAGGGATTTGGGGAGGG - Intergenic
974283185 4:59826091-59826113 GTTCTCAAGGGCTATGGGGAAGG - Intergenic
974744784 4:66057838-66057860 GTGTTCAAGTGATTTGTGGAAGG - Intergenic
976318720 4:83687052-83687074 GTTTTAAAGGGTCTGGGTGAGGG - Intergenic
976650087 4:87424722-87424744 CTTTTAGTGGGATTTGAGGAAGG + Intronic
978259670 4:106740232-106740254 CCTTCAAAGGTATTTGGGGAAGG + Intergenic
978572347 4:110152140-110152162 GTTTTAAAGATATTTTGGGGGGG - Intronic
978836159 4:113151759-113151781 ATTTTAAAGAAATTTGGTGAAGG + Intronic
979161106 4:117462553-117462575 GTTTGCAAGAGCTTTGGGGATGG - Intergenic
979369361 4:119865130-119865152 GTTTAAAAGGAATATGGGCAGGG - Intergenic
980530641 4:134047878-134047900 ATTTTAAAGGGAGTTGGAGAAGG + Intergenic
980833700 4:138163372-138163394 GTCTTAAAGCAACTTGGGGAAGG + Intergenic
981140023 4:141257299-141257321 ATTTTAGAGAGTTTTGGGGAGGG - Intergenic
982700015 4:158650210-158650232 GTTTTCTAGGGGTTGGGGGAAGG + Intronic
983178141 4:164615625-164615647 ATTTTAAATGGCTTTGGGCAGGG + Intergenic
983210480 4:164953248-164953270 GCATTAAAATGATTTGGGGAAGG - Intergenic
983495609 4:168439249-168439271 GTTGTAAAGGTATTTGTAGATGG + Intronic
984008564 4:174343148-174343170 GTTGCCAAGGGGTTTGGGGAAGG - Intergenic
985382252 4:189406684-189406706 TTTCTCATGGGATTTGGGGAAGG + Intergenic
985545453 5:506769-506791 GTTTTAAAGTTATTGGGGGCCGG + Intronic
986050739 5:4087905-4087927 GTTTTGAAGGGATTTGCATATGG + Intergenic
986147228 5:5089715-5089737 GTATTAAGGGAATTAGGGGAAGG - Intergenic
986219858 5:5758407-5758429 ATTTTAAAGGCATGTTGGGAAGG - Intergenic
987006856 5:13719422-13719444 GTTTTAATGGAATTTGGGGAGGG - Intronic
987555882 5:19447722-19447744 ATTTTCTAGGGATTTTGGGATGG - Intergenic
988808178 5:34759834-34759856 GGTCTAAGGGGATTTGGGAATGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990376737 5:55177886-55177908 TTTTTCAAGGGACTTGGGGCAGG - Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
992778755 5:80109851-80109873 GTTTTATAGGGGCTGGGGGAGGG - Intergenic
993143673 5:84067256-84067278 GTTGTAAAGGGATTTGGAATGGG - Intronic
993452230 5:88086337-88086359 CTTTGAAAGGGATTTGAGCAGGG - Intergenic
993841140 5:92880250-92880272 TTTTTAAAGGGGTTGGGGGATGG + Intergenic
994459300 5:100052628-100052650 ATTTTAATGGGTTTTGGTGAAGG + Intergenic
995796742 5:115949224-115949246 GTTTCTAGGGGATGTGGGGAGGG - Intergenic
997628086 5:135344965-135344987 GTTTTAAAGGGCCTGGGGAAAGG + Intronic
997892928 5:137691072-137691094 ATTTTAATGGGGTTTTGGGAGGG - Intronic
997910904 5:137872259-137872281 ATTATAAAGGGAATTTGGGAGGG - Intronic
999138480 5:149340179-149340201 GATTTTAGGGGATATGGGGAGGG + Exonic
999496087 5:152099756-152099778 GTTTTGCAGTGTTTTGGGGAGGG - Intergenic
1000841257 5:166221335-166221357 GTTTTGAATGGATGTGGGAATGG + Intergenic
1001169766 5:169407991-169408013 GTTTTTGATGGATTTGGGGCAGG + Intergenic
1001616637 5:173048155-173048177 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1003485714 6:6576869-6576891 ATTTTACAGGGATTTGAGGCAGG - Intergenic
1003551939 6:7108135-7108157 CTTTTAAAGAACTTTGGGGATGG + Intronic
1004677359 6:17856089-17856111 GTTTTCAAGTGCCTTGGGGAAGG - Exonic
1005214892 6:23513892-23513914 CTTTTATAGGGATTTGGTTAGGG - Intergenic
1005278082 6:24241726-24241748 GGTTTGAAGGACTTTGGGGAAGG - Intronic
1005789668 6:29284876-29284898 ATGTTGAAGGGATTTGGAGAGGG + Intergenic
1006082894 6:31577571-31577593 GTAATAAAGGGATTGGGGCAGGG - Exonic
1007069508 6:39025613-39025635 GTTTGAATGGGAGTTGGGGGAGG - Intronic
1007125068 6:39419054-39419076 CTTTTAAAAGGATTTGAGGCTGG + Intronic
1008099284 6:47373887-47373909 GATTAAAAGGGATTGGGGCAGGG + Intergenic
1009439379 6:63658399-63658421 ATTTTAATGGGATTTGGGGGTGG + Intronic
1009911749 6:69938413-69938435 ATTCAACAGGGATTTGGGGAAGG - Intronic
1013801616 6:113951810-113951832 GTTTTAGAAGGATTTGAGAATGG - Intronic
1014838539 6:126189093-126189115 GCCTTTAAGGGATTTGGCGAAGG + Intergenic
1014843468 6:126246779-126246801 ATTTTAATGGGATTTATGGAGGG - Intergenic
1015352368 6:132236404-132236426 TTTTTAAAAGGATTCGGGAATGG + Intergenic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1018103134 6:160458876-160458898 GTCTTCAAGGGATGTGGGCAAGG - Intergenic
1018111103 6:160537674-160537696 GTCTTCAAGGGACTTGGGCAAGG - Intronic
1018638331 6:165884289-165884311 GTTTTATAAAGCTTTGGGGAAGG - Intronic
1019984169 7:4642857-4642879 GTTCTAAAAGGATTTGAGAAAGG + Intergenic
1020402750 7:7796850-7796872 GTTTTTAAGGGTTTTGGAGTGGG - Intronic
1021725611 7:23545325-23545347 CTTTTTTAAGGATTTGGGGAGGG - Intergenic
1024395746 7:48864757-48864779 AAATTAAAGGGATTTGGGGGTGG + Intergenic
1024399488 7:48907519-48907541 AAATTAAAGGGATTTGGGGGTGG - Intergenic
1024448042 7:49504682-49504704 GATTTTAAGGGATTAGGGAAGGG - Intergenic
1025711621 7:63915714-63915736 GTTTTAAAGTAAATTTGGGAGGG + Intergenic
1026395333 7:69947108-69947130 GGTTTAAAGGGATTGAGGGAGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027785313 7:82573135-82573157 TTTTCAAAGAGATTTGGAGAAGG + Intergenic
1027959954 7:84932565-84932587 GTAATAAATGGATTTGGGCATGG - Intergenic
1028107459 7:86896631-86896653 ATTTTAATGGAATTTGGGCATGG + Intronic
1028151417 7:87378045-87378067 TTTATAAAGGGGTTTGGGGCTGG + Intronic
1028635283 7:92981868-92981890 GGTTTCCAGGGATTTGGGGGTGG - Intergenic
1028945740 7:96577590-96577612 CCTTTACATGGATTTGGGGATGG + Intronic
1032281685 7:130508241-130508263 TATTTAAAATGATTTGGGGAGGG - Intronic
1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG + Intronic
1033902879 7:146164375-146164397 TTTTTAAAGTTATTTAGGGAAGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034567405 7:151926448-151926470 GTTGTGCTGGGATTTGGGGATGG - Intergenic
1036399554 8:8395937-8395959 GTGGTAAAGGGATATGGGGCTGG + Intergenic
1036497767 8:9284954-9284976 GATTTAAGAGGATTTGGGGAAGG + Intergenic
1036627591 8:10484297-10484319 GTTGTAAAGGGATTCAGCGAAGG + Intergenic
1037333120 8:17764067-17764089 GTTTTAAAGGGTTTTTTGGTGGG + Intronic
1037604346 8:20424866-20424888 GTTTGAAATGGATTTGAGGGTGG + Intergenic
1038489375 8:27958824-27958846 CTTTGAAAGAGATCTGGGGATGG + Intronic
1039838914 8:41279700-41279722 GGTATAAAGGGATTTAGAGAGGG + Intronic
1040355584 8:46614934-46614956 ATCTTTGAGGGATTTGGGGATGG - Intergenic
1040920688 8:52613090-52613112 CTTTTTATGGGATTTGGGGATGG + Intergenic
1043146477 8:76661750-76661772 TTTTTAAAGGGATTTAGTAATGG - Intergenic
1045147873 8:99367965-99367987 TTTTTAAAGGGATTGGGGAAGGG + Intronic
1045295219 8:100866594-100866616 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1046017295 8:108620408-108620430 GTTGTAATGGGATATGGGTAGGG + Intronic
1046183673 8:110685110-110685132 GTGTTACAGGGATATGAGGAAGG - Intergenic
1046718622 8:117594610-117594632 CTTATAAAGGGATCTGGGCAAGG - Intergenic
1046811907 8:118542505-118542527 GTTCTAAGGGCATTTGGAGATGG + Intronic
1047559675 8:125973092-125973114 ATTTTAAAGGGCTTGAGGGAGGG - Intergenic
1048245263 8:132789752-132789774 GTTTTAAGTGGAATTAGGGAAGG + Intronic
1048348649 8:133597874-133597896 AGATAAAAGGGATTTGGGGACGG + Intergenic
1048573141 8:135671360-135671382 CTCATAAAAGGATTTGGGGATGG + Intergenic
1049137749 8:140919721-140919743 ATTTTAAAGGGCTTTGGGAATGG - Intronic
1049226425 8:141453013-141453035 GTTATCAAGGGCTATGGGGAGGG + Intergenic
1049901808 9:175697-175719 ATTTTAAATGAATTTGGGGAAGG - Exonic
1050312146 9:4364237-4364259 GGTCTACAGAGATTTGGGGAGGG - Intergenic
1050581593 9:7062734-7062756 GTTTTAAGGGAATCTGTGGAAGG + Intronic
1050948580 9:11558811-11558833 GAGTTGAAGGGATTTGGGAATGG + Intergenic
1051295813 9:15594844-15594866 GTTTTAAAGGAAATTTGTGAAGG + Intronic
1051529689 9:18087193-18087215 TTTTTAAAAGCATTTAGGGAGGG - Intergenic
1051637862 9:19197217-19197239 TGTTTAAAGGGATTTGGGGCCGG + Intergenic
1051985611 9:23083258-23083280 GTTTTGAAAGGAATTTGGGATGG + Intergenic
1052044112 9:23774655-23774677 TTTTTATGGGGAGTTGGGGAGGG - Intronic
1052972972 9:34388745-34388767 GTTTTAGAGGGGTTTTAGGAGGG + Intronic
1053422695 9:37989798-37989820 GTTTTAAAGAGGAGTGGGGAAGG + Intronic
1053744843 9:41185992-41186014 ATTTTAAATGAATCTGGGGAAGG - Exonic
1054482428 9:65679231-65679253 ATTTTAAATGAATCTGGGGAAGG + Exonic
1054683505 9:68245278-68245300 ATTTTAAATGAATCTGGGGAAGG + Exonic
1055967507 9:81880154-81880176 GTTTTAAAGGAATTTGGAGGTGG + Intergenic
1056025605 9:82491408-82491430 GTGTTAAAAAGTTTTGGGGAGGG - Intergenic
1056104048 9:83329296-83329318 GTTTGGAAGGGACTTGGGAAGGG + Intronic
1056657924 9:88524220-88524242 GCTTTTAAGAGATTTGGGCAGGG - Intergenic
1057776670 9:98016611-98016633 ATCTTAAAGGGATTTGAGAAAGG + Intergenic
1058018460 9:100063953-100063975 CTTTTAAATGAATTTGGGTATGG - Intronic
1058101368 9:100920943-100920965 ATTTCAAAGGGAATTTGGGAGGG + Intergenic
1058675328 9:107395321-107395343 GTTTTACAGGGGTTTTTGGATGG - Intergenic
1058802616 9:108559756-108559778 ATTTTAACAGGATTTTGGGAAGG - Intergenic
1059184549 9:112255900-112255922 ATTCTATAGGGATTTGGGGGAGG - Intronic
1059257093 9:112940673-112940695 GTTTTAATGGGGTTTCAGGAGGG + Intergenic
1059286870 9:113180941-113180963 CTTTTAAAGGGAGATGGGCAAGG - Intronic
1059445956 9:114337905-114337927 GTTTTAAAGTGCTGTGGGAATGG + Intronic
1059534505 9:115068925-115068947 GTTTTAGAGGGATTTGTGGGAGG - Intronic
1059866873 9:118524472-118524494 ATTTTATATGAATTTGGGGATGG - Intergenic
1059993770 9:119889848-119889870 GTTTTACATAGAGTTGGGGAGGG + Intergenic
1060214226 9:121728800-121728822 GTGTAAATGAGATTTGGGGAGGG + Intronic
1061910377 9:133719241-133719263 TATTTTATGGGATTTGGGGAAGG - Intronic
1185851273 X:3490989-3491011 TTTTTACAGGGATCTGGGGCAGG - Intergenic
1185947840 X:4397742-4397764 CTTTTAAAGGGAGTTGTGGGTGG - Intergenic
1187919380 X:24185950-24185972 GTTTTAGGGGGGTTTTGGGAGGG - Intronic
1188155745 X:26740121-26740143 GTTTTAATGGTATTTGTGTACGG + Intergenic
1189079737 X:37958477-37958499 ATGTTAATGGGATTTGGAGATGG - Intronic
1189894526 X:45640490-45640512 GGTTTATAGGAATTAGGGGAGGG - Intergenic
1189962912 X:46341508-46341530 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1190114636 X:47618776-47618798 GTTTAAAAGGGCTTTAAGGACGG + Intronic
1191921390 X:66260492-66260514 GTTTTGAAGTAATTTGGAGAGGG - Intronic
1192587389 X:72329744-72329766 ATTTTTAAGCGAATTGGGGAGGG - Exonic
1193138616 X:78001575-78001597 GTTGTAAGGGGAAGTGGGGATGG - Intronic
1193202617 X:78709804-78709826 GTATTAGAGGAATTTGAGGAAGG + Intergenic
1195312930 X:103651280-103651302 GTTTTAAAGAGCTGTGGGGATGG + Intergenic
1195737584 X:108029706-108029728 CTTTTAAAGGCAATTGGTGAAGG - Intergenic
1196476900 X:116097810-116097832 GCTTTACAGAGATTTGTGGATGG - Intergenic
1196610024 X:117702125-117702147 GATTGAAAGGGAGTTGAGGATGG + Intergenic
1196914019 X:120513409-120513431 GTTTTAAAGGGTTTTGGAGTGGG - Intergenic
1197419126 X:126216216-126216238 GTTTTAAAGAAAATTGAGGATGG + Intergenic
1198250783 X:134877529-134877551 GTCATAAAGGGATTTGGGATGGG - Intergenic
1198572104 X:137968478-137968500 ATAATAAAGGGATGTGGGGATGG - Intergenic
1199080645 X:143572977-143572999 ATTTTGAAGGGGTTTTGGGATGG - Intergenic