ID: 1016585027

View in Genome Browser
Species Human (GRCh38)
Location 6:145674391-145674413
Sequence CTGCAGTTCCTTGGGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016585020_1016585027 -4 Left 1016585020 6:145674372-145674394 CCTCTGCTCCTCCAAAGGACTGC 0: 1
1: 19
2: 1233
3: 3549
4: 2980
Right 1016585027 6:145674391-145674413 CTGCAGTTCCTTGGGGGCAATGG 0: 1
1: 0
2: 2
3: 25
4: 260
1016585018_1016585027 4 Left 1016585018 6:145674364-145674386 CCAGAGCACCTCTGCTCCTCCAA 0: 1
1: 136
2: 356
3: 703
4: 1501
Right 1016585027 6:145674391-145674413 CTGCAGTTCCTTGGGGGCAATGG 0: 1
1: 0
2: 2
3: 25
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016585027 Original CRISPR CTGCAGTTCCTTGGGGGCAA TGG Intronic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901733054 1:11294478-11294500 CTGCAGTTCCTTGCTTGTAAGGG + Intronic
902631251 1:17705863-17705885 CTGTGGTTCCCTGGGGGTAATGG + Intergenic
902654627 1:17859022-17859044 GGGCACTTCCTTGGGGTCAAAGG - Intergenic
903376136 1:22867320-22867342 CTGCAGGGCCTTGGGGACAGGGG + Intronic
906911433 1:49955762-49955784 GGGCAGTTCATTGGGGGCAGAGG - Intronic
909447292 1:75761293-75761315 GTGCAGATACTTGGAGGCAATGG + Exonic
910114903 1:83721335-83721357 CTGCAATTCAGCGGGGGCAAAGG - Intergenic
910146496 1:84086256-84086278 CTGGGGTCCCATGGGGGCAAGGG - Intronic
911519164 1:98908224-98908246 CTGTAGTTCTTTAGGAGCAAAGG + Intronic
912381500 1:109250187-109250209 CTGTCGTTCCTTGGGGTCCAGGG + Exonic
912421339 1:109544166-109544188 CTGCAGTTCCTTCAGGGGACTGG + Exonic
916988174 1:170213980-170214002 CAGCAGTTGCTTGGGTGAAATGG + Intergenic
918472722 1:184890891-184890913 CTGCATGTCCTTGTGGGCATAGG - Intronic
920165004 1:204029616-204029638 CTTCATTTGCCTGGGGGCAAGGG - Intergenic
920801368 1:209190844-209190866 GTGCAGTTCTTTGTGGGAAAGGG + Intergenic
922207268 1:223459431-223459453 CTGCAATTCTATGGGGGCAAGGG - Intergenic
922326136 1:224530142-224530164 CTGCAGTTCCCTGGGTCCCAAGG + Intronic
922702368 1:227769319-227769341 CTGGTGTGCCTTGGGGGCAAGGG + Intronic
922766076 1:228157311-228157333 CTGCAGGGGCTTGGGGGCTAGGG + Intronic
923592067 1:235328059-235328081 CTGCAGCTCCCTCCGGGCAAAGG + Exonic
923964619 1:239123522-239123544 CTGCATCTCCCTGGGTGCAAAGG + Intergenic
924563142 1:245173676-245173698 CTGCAGTCCCTTGGAGGGAAAGG + Intronic
1065281855 10:24147260-24147282 TTGCAGTTCAGTGGGGACAAGGG + Intronic
1066804054 10:39225534-39225556 TTGCAGCTCCATGGGGCCAATGG + Intergenic
1067142210 10:43667447-43667469 CGACAGTTCCCTGGGGCCAAGGG + Intergenic
1070793696 10:79204597-79204619 GTTGAGCTCCTTGGGGGCAAAGG + Intronic
1071434670 10:85635988-85636010 CTGAAGTTCCAAGAGGGCAAGGG - Intronic
1072156050 10:92724644-92724666 GTGCAGTTCCTTGGGGGCTCTGG - Intergenic
1072319244 10:94232845-94232867 CTGGAGCTCCCTGGTGGCAAAGG - Intronic
1073562690 10:104510255-104510277 CTGCAGTTCCCTGAGGTCACAGG - Intergenic
1073804342 10:107080362-107080384 CTGGAGTGACTTGGGGTCAAGGG - Intronic
1074008289 10:109450867-109450889 CTCCAGTTCCCTGGGGGCTAAGG - Intergenic
1074239078 10:111619057-111619079 CTGAATTTCCTTGAGAGCAAAGG + Intergenic
1075394578 10:122117763-122117785 CTGAAGCTCCTTGAGGGCATGGG + Intronic
1075862860 10:125692361-125692383 CCACAATTCCTTGAGGGCAAGGG - Intergenic
1076150385 10:128157508-128157530 CTGGAGTTCAGTGGGGGCAGGGG + Intergenic
1076302884 10:129441351-129441373 CTGCAGTTTCTTGCAGGCACAGG + Intergenic
1076511636 10:131018279-131018301 ATTCAGTTCCTTGGGGCCAATGG - Intergenic
1078185696 11:9050516-9050538 CTGGAGGTCCATGGGGGCCAGGG - Intronic
1079120408 11:17679909-17679931 CTGCAGATTCTTTGGGGGAAAGG - Intergenic
1079135585 11:17774516-17774538 CTGCACTCCCTGGGGGGCAGGGG - Intronic
1079908311 11:26277064-26277086 CTTCATTTACTTGGGGGCAGGGG + Intergenic
1080649089 11:34208881-34208903 CTGCAGGTCCAGGGGGGCAGGGG - Intronic
1081616327 11:44593430-44593452 CTTCAGACCCTTTGGGGCAAAGG - Intronic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1083637863 11:64129986-64130008 CTGCAGTGCCTTTGAGGCACTGG - Intronic
1083755438 11:64789467-64789489 CTGCAGGCCCTTTTGGGCAAAGG - Exonic
1084767855 11:71324112-71324134 TTGCAGTTCCTTGGAGGCAACGG - Intergenic
1084978419 11:72815680-72815702 CTGCAGTACCCTGGGGGCTGAGG + Intronic
1086179196 11:83930180-83930202 CTGCTGTTCCCTTGGTGCAATGG - Intronic
1089300919 11:117498127-117498149 CTGAAGCTCCTTGGGGGCTGGGG - Intronic
1089374633 11:117985952-117985974 TTGCAGGCCCTTGAGGGCAAAGG - Intergenic
1090182902 11:124716592-124716614 CTGCAGTTCCTCTGGGGTAGTGG - Intergenic
1091234107 11:134008282-134008304 CTGCATTTACTTGGGGGCAGAGG - Intergenic
1091908213 12:4206520-4206542 CTCCTGTTCCTTTTGGGCAATGG + Intergenic
1091981868 12:4871183-4871205 CTGTGGGTCCTAGGGGGCAATGG - Intergenic
1091995345 12:4988645-4988667 AAGTGGTTCCTTGGGGGCAAAGG + Intergenic
1092107283 12:5930770-5930792 CTGCAGGACCTCTGGGGCAAGGG - Intronic
1092273547 12:7041756-7041778 GTGCAGATGCTTGGGTGCAAAGG - Intronic
1092525241 12:9305832-9305854 CTGGAGTTCCCTGAGGGCAGGGG - Intergenic
1093996012 12:25643687-25643709 ATGCAGTTCCCAGGGGGCCATGG - Intronic
1094510979 12:31096454-31096476 CTGGAGTTCCCTGAGGGCAGGGG - Intronic
1100356317 12:93834125-93834147 CTGCAGGCCCATGGGGGTAAGGG - Intronic
1100882066 12:99030211-99030233 CTGCACTTGCTGGGGAGCAAAGG - Intronic
1103152245 12:118650927-118650949 CTGCACTGCCTTGGGGCCTACGG - Intergenic
1106027538 13:25969249-25969271 CAGCTGTTCCTTGTGGGGAAGGG - Intronic
1106618479 13:31352372-31352394 CTGCATTTCCTTGGTACCAATGG + Intergenic
1106895418 13:34294999-34295021 GTGCAGTAGCTTGGGGGAAATGG + Intergenic
1107588475 13:41879032-41879054 GTGCAGTGCCTTGGGAACAAGGG - Intronic
1110692523 13:78447877-78447899 ATGCAATTCCTTGGGGGTGAAGG - Intergenic
1112220680 13:97486714-97486736 CTGCATTTTCTTGGAGGGAAAGG - Intergenic
1112650282 13:101389389-101389411 CTGCAGTTTCTTGGGGACATTGG - Intronic
1112704527 13:102051490-102051512 CAGCAGGTCCTTTGGGGCACTGG - Intronic
1113353497 13:109553596-109553618 CTGGGGTTCCTTGGTGGAAATGG - Intergenic
1113594630 13:111522244-111522266 CTGCAGATCCGTGAGAGCAAGGG - Intergenic
1113785297 13:112999267-112999289 CTGAAGTTTCTGGTGGGCAAAGG - Intronic
1114413243 14:22519758-22519780 CTGCACCTCCTGGGCGGCAAGGG - Intergenic
1115399005 14:32938273-32938295 CGGGAGCTCCTTGGGGGCAGCGG - Intronic
1115468128 14:33738479-33738501 CTGTAACTCCTTGGGGGCATTGG - Intronic
1115544343 14:34451951-34451973 CTGCAGTTTTTTGAGGTCAAAGG - Intronic
1118442355 14:65823221-65823243 TTGGAATTCCTTGGGGGGAAAGG + Intergenic
1118934496 14:70274505-70274527 CTGCACTTTCTAGGGTGCAAGGG + Intergenic
1119408360 14:74412524-74412546 GTGGTGTTCCTTGGGGGCATAGG - Intronic
1119421633 14:74510904-74510926 CTGCAGTTCCCAGGGAGGAAGGG - Intronic
1121121097 14:91376452-91376474 CTGTGGTTCCTGGGGGGCAGGGG - Intronic
1121729000 14:96173419-96173441 CATCAGCTCCTTGGGGGCAGAGG - Intergenic
1122742954 14:103882315-103882337 CTGCAGATCCGTGGGGGAAAAGG + Intergenic
1123950879 15:25273625-25273647 CTGGAGTTTATTTGGGGCAAAGG - Intergenic
1124442047 15:29692868-29692890 CAACAGTCCCTTGGGGGTAAGGG + Intergenic
1124689057 15:31806598-31806620 CTGCTGGTCCTGGGGGTCAAAGG + Intronic
1125371514 15:38983321-38983343 TTGCATTTCCTTGGGCACAAGGG + Intergenic
1127139460 15:55960123-55960145 CTGCAGTCCTTTGGGGGTATGGG - Intronic
1127901709 15:63345815-63345837 CTGGAGTTGCTTTGGGGAAAAGG - Intronic
1128199626 15:65793230-65793252 CTGCAGTTTCCTGAAGGCAAAGG - Intronic
1128674886 15:69601232-69601254 TTTCAGTTCCTTGAGGGCAGAGG + Intergenic
1128706447 15:69840568-69840590 TAGAAGTTCCTTGAGGGCAAGGG - Intergenic
1131318105 15:91358635-91358657 GGGCAGTCCCATGGGGGCAATGG + Intergenic
1132226932 15:100150105-100150127 TTGCAGTTCCTTGGGAGCCCAGG + Intronic
1132477549 16:148806-148828 CTGCAGTGCCTTCTGGGCACAGG + Intergenic
1133805409 16:9122804-9122826 CTGAAGTTCCCTGGGGAAAAGGG + Intergenic
1137750258 16:50856387-50856409 CAGCAGTTCCTTCTGGGAAAGGG + Intergenic
1138181063 16:54940265-54940287 CTGCAGGCCCATGGGGACAATGG + Intergenic
1141369381 16:83472994-83473016 CTCCAGTTCCATGGGGGCACAGG + Intronic
1143408039 17:6690982-6691004 TTGCAGTTCCTTCAGGGCCAGGG + Intronic
1143913109 17:10268263-10268285 CTGAAGTTCCTTGGGGAAAAGGG - Intergenic
1146821440 17:35986142-35986164 CTCCATGTCCTTGAGGGCAAGGG + Intronic
1147566412 17:41538999-41539021 CTGCTCTTCCTTGGGGCAAAGGG - Intergenic
1148962329 17:51403785-51403807 CTGGAGTTCCTTGGAGGGAGAGG + Intergenic
1151123869 17:71823954-71823976 TTGCAGTTCTTTGGAGGAAAGGG + Intergenic
1151170914 17:72245540-72245562 CTGCAGCTCCCTGAGGGGAAAGG - Intergenic
1151195758 17:72430279-72430301 CTGAGGTTCCTTGGGGGCATAGG - Intergenic
1151885610 17:76921627-76921649 CTGCAGATCCTGGGGGGCGCAGG + Intronic
1152296769 17:79471976-79471998 CTGGAGTTCCTTAAGGGCACAGG - Intronic
1153001309 18:458010-458032 CTGCATTTTCTTTGTGGCAAAGG + Intronic
1155157204 18:23167787-23167809 CTGCAGGTCGTTGGGGGCCTCGG + Intronic
1155516420 18:26627949-26627971 CTGCAGATCCCTGGGGGCTCTGG - Intronic
1155970541 18:32079048-32079070 GGGGAGTTCCTTGAGGGCAAAGG + Intergenic
1155978943 18:32160861-32160883 CTGCAGTGCCTCTGGGGTAAAGG - Intronic
1157123318 18:44932983-44933005 ATGCAGCTCCTTGTGAGCAACGG - Intronic
1157862299 18:51152236-51152258 CTCCACTGCCTTGGGGGCAGGGG - Intergenic
1158414671 18:57239271-57239293 TTGCAGTCTCTTGGGGGAAAGGG + Intergenic
1158894313 18:61898731-61898753 CTGCACTTCCCCGCGGGCAAAGG + Intergenic
1160118872 18:76109158-76109180 CTGCAGCTCCTTGGGCCCCAAGG + Intergenic
1161022078 19:2015327-2015349 GTGCACTTCCTGGTGGGCAAGGG - Exonic
1161425855 19:4202739-4202761 ATGGAGTCCCTTGGGGGCCACGG + Intronic
1161532876 19:4800714-4800736 CTGCAATTCCATGGGGGCGGCGG - Exonic
1161751710 19:6102549-6102571 CTGCAGGGCCTTGGAGGCCATGG - Intronic
1162490953 19:10991331-10991353 CTGCAGGGCCTTGGGGCCACCGG - Intronic
1162520788 19:11178348-11178370 CTCCAGTTCGTGGGGGTCAACGG - Exonic
1163581862 19:18144153-18144175 CTGGGGTTCCTTGGGGGCTGGGG - Intronic
1164925982 19:32130288-32130310 CTTGGCTTCCTTGGGGGCAAAGG - Intergenic
1166059204 19:40314670-40314692 CTCCATCTCCTTGGGGGCAAGGG - Intergenic
1167583506 19:50359964-50359986 CTGGAGTTCCTACGGGGTAATGG + Intronic
925456823 2:4023205-4023227 CAGCAGTTCCCTGGAGCCAAAGG + Intergenic
926152797 2:10434284-10434306 CTGCAGGGCCTTGAGGGGAATGG + Intergenic
927086235 2:19676300-19676322 CTGGACTTTCTTCGGGGCAAGGG - Intergenic
927406959 2:22781520-22781542 TTGCATTTCTTTGGGGTCAATGG + Intergenic
932263680 2:70347778-70347800 CTCCAGTTACCTGGGGGCAGGGG + Intergenic
932442641 2:71747386-71747408 CTGCTCTGCCTTGTGGGCAACGG - Intergenic
934318457 2:91948303-91948325 TTGCAGCTCCTTGCGAGCAATGG + Intergenic
934880185 2:97970241-97970263 GAGCAGTTCCTTGGGGCCAAGGG - Intronic
935369822 2:102333472-102333494 CTGAATTTTCTTTGGGGCAAGGG + Intronic
935563520 2:104583131-104583153 TGGCTGTTACTTGGGGGCAAAGG - Intergenic
936502190 2:113075006-113075028 CTGCAGATTCTAGAGGGCAAGGG - Intronic
937304031 2:120860293-120860315 ATGCAGCTCCTTGGGGGTACTGG - Intronic
938733308 2:134163259-134163281 CTGGAGGGCCTTGGGGGCCAGGG + Intronic
939871712 2:147533441-147533463 CTGCAGTTGCCTCGGTGCAAAGG + Intergenic
941451927 2:165670354-165670376 CTCCAGTTCATTGGGATCAAGGG + Intronic
941545636 2:166847093-166847115 CTGGAGTTCCTTGGTGGCTGTGG - Intergenic
942364829 2:175214428-175214450 CAGTAGTTGCTTGGGGGCAGTGG - Intergenic
1168790991 20:575543-575565 CTGCAGTGAGTTGGGGGCACTGG + Intergenic
1168919638 20:1520595-1520617 CTGAGGTTGGTTGGGGGCAAAGG + Intergenic
1169122775 20:3107307-3107329 CTGCGGTTTGGTGGGGGCAAAGG - Intergenic
1169255381 20:4092874-4092896 GTGCAGGTCTTTGGGGGCCATGG - Intergenic
1170650779 20:18239116-18239138 CTGCAGGTCCCTGGAGACAACGG + Intergenic
1172199295 20:33113996-33114018 CTGCAGGACCTTGTGGGCAGTGG - Intergenic
1172409708 20:34711939-34711961 CTGCATTCCCATGAGGGCAAAGG + Exonic
1172972131 20:38881327-38881349 GCGCAGTGCCTTGGGGGCACAGG + Intronic
1173255312 20:41390441-41390463 GGGGAGTTCCTTGGGGGCAGTGG - Intergenic
1174171142 20:48618897-48618919 CTGCAGTCCCTATGGGGCACGGG + Intergenic
1174503618 20:51002998-51003020 CTGCAGGTCTTTGGGGGCACGGG + Intergenic
1175132079 20:56796866-56796888 CTGCAGTTCCTAAGGGGGCAAGG - Intergenic
1175958737 20:62624405-62624427 CTGCCCTTCCTTGAGAGCAAGGG + Intergenic
1177552638 21:22645677-22645699 TTGCAGGTCCTTGTGGGTAAAGG + Intergenic
1179351109 21:40611766-40611788 CTGAAGTCCCATGAGGGCAAGGG - Intronic
1179447368 21:41441567-41441589 CTGCAGAACCATGGGGGCAGTGG - Intronic
1180068318 21:45423857-45423879 CTGCAGTGTCCTGGGGGCAGAGG + Intronic
1182161852 22:28130298-28130320 CTGCTTTTCCTTGGGAGCAAAGG - Intronic
1183142154 22:35952452-35952474 CTAAAGTTCCTTGAGGGCAAAGG - Intronic
1183343236 22:37293670-37293692 CTGCAGATCCTGGGGAGAAAGGG + Intronic
1185340973 22:50290957-50290979 CTGGAGCTCCTTGGGGTCACAGG - Intronic
1185373059 22:50469748-50469770 CTGCAGCTTCTTGGGGGCCGGGG - Intronic
952749720 3:36815458-36815480 CATCAGTTCCTTAGGGGTAAAGG + Intergenic
953854366 3:46489494-46489516 CTGCAGCACCTTGGGGACCAAGG + Intergenic
954103078 3:48392953-48392975 CTGCAGTGCTTTGTGGGCAGAGG + Intronic
954257859 3:49418810-49418832 CTGCAGTTTCTAATGGGCAAAGG + Intronic
954314149 3:49792110-49792132 CTGAAGTTCCTTGTGGACATAGG - Intronic
955740963 3:62091537-62091559 AAGCAGTTCCTTGGGGTCCAGGG - Intronic
956182268 3:66528503-66528525 CTGCAGCTCCTTTTGGGCTATGG + Intergenic
959420553 3:106123061-106123083 GTGCAGTTTCTTTAGGGCAAAGG + Intergenic
961005143 3:123400197-123400219 ATGCAGTTACTTGGGAGCAGAGG - Intronic
961156828 3:124686701-124686723 CTGCTGTTCCTTGGAGTCCATGG - Intronic
961450361 3:126999745-126999767 CTGCTGTGTCCTGGGGGCAAAGG + Intronic
961722495 3:128906163-128906185 CTGCAGATCCTCGGGGGCTTGGG + Exonic
962446461 3:135470274-135470296 CTGGAGTTCCTAGAGGGCCAAGG + Intergenic
966975053 3:185075786-185075808 CTGTAGTTCCCTCGAGGCAAGGG + Intergenic
967321195 3:188196996-188197018 CTGCATTTCCTTGAGAGCAATGG + Intronic
967447697 3:189585881-189585903 TTGCCTTTCCTTTGGGGCAAAGG + Intergenic
968483131 4:845645-845667 CTGGAGCTCCCTGGGGGCACAGG + Intergenic
969339152 4:6529547-6529569 CAGCACTTCCATGGGGGCACAGG - Intronic
969533316 4:7741183-7741205 CTGCAGTTCCTTATAGGCGAAGG + Exonic
972680575 4:41302890-41302912 CAGTAGTTCCTTGGGTTCAATGG + Intergenic
972960736 4:44448776-44448798 CTGCTGCTCCTTTGGGGCGAGGG + Exonic
973148012 4:46853149-46853171 CTGTATTTCCTTAGGAGCAATGG + Intronic
974550001 4:63359631-63359653 CTGAAGTTCCTGGTGGCCAAGGG + Intergenic
978472425 4:109084201-109084223 TGGAAGTTCCTTGAGGGCAAAGG + Intronic
981176610 4:141690169-141690191 CTGGAGTTCCGTGTGGGCATGGG - Intronic
984388295 4:179093172-179093194 CTGTAGTTCCTTGGGTCCAGAGG + Intergenic
986115110 5:4766051-4766073 CTACTGTTCCTGGGGGTCAAGGG + Intergenic
986377525 5:7147794-7147816 CTGCAGCTCCCTGGGAGTAATGG - Intergenic
988977158 5:36526851-36526873 GAGCACTTCCTTGGGGGCAGCGG - Intergenic
990299421 5:54435794-54435816 ATGCAGTTCCTTGAGGTCACAGG + Intergenic
991295515 5:65076104-65076126 CTGCAGCTCCTGGGGAGGAAAGG + Intergenic
992230392 5:74657957-74657979 CTGGAGATTCTTGGGAGCAAAGG - Intronic
995517632 5:112969615-112969637 GCGCAGTTCCATGGGGGAAATGG + Intergenic
997192289 5:131948306-131948328 CTTGAATTCCTTGGTGGCAAGGG + Intronic
997419552 5:133755203-133755225 ATGCAGTTCCTTTTGGCCAAGGG + Intergenic
997717159 5:136050916-136050938 CTTAAGTTTCTTGGAGGCAAAGG - Intronic
999119132 5:149195505-149195527 CTTCAGCTCCTTGGGGGCAATGG + Intronic
999641439 5:153677112-153677134 CAGCTGTTCCCTGGGGCCAAGGG + Exonic
999932961 5:156453933-156453955 CAGCAGTTGCTTGGGGCCAATGG + Intronic
1000390662 5:160719443-160719465 CAGTAGTTCCTGGAGGGCAAAGG + Intronic
1001126236 5:169022110-169022132 CTGCAGTGGCATGGAGGCAAGGG - Intronic
1001617433 5:173054417-173054439 GGGCAGTTCCTTGGGGTCAGGGG - Intergenic
1001773496 5:174312318-174312340 CTGCAGCTCGCTGGCGGCAAGGG + Intergenic
1002452734 5:179328427-179328449 ATGCAGGTCATTGGGAGCAAAGG + Intronic
1003116136 6:3284952-3284974 CTGCAGTTCTTGGAGGGCAACGG + Intronic
1003780931 6:9425462-9425484 CTGCAGTTACATGGAGACAAAGG - Intergenic
1003819820 6:9883410-9883432 ATGCAGCTCCTTGGCAGCAACGG + Intronic
1005753252 6:28903192-28903214 CTCCATTTCCTTTGGGGGAAGGG - Exonic
1006780247 6:36627673-36627695 GTGCACTGCCTTGGGGGGAAAGG + Intergenic
1007385210 6:41516039-41516061 GAGCGGTTCCCTGGGGGCAAGGG + Intergenic
1008675531 6:53813917-53813939 CTGCAGTTCCTTTGAGCCACAGG - Intronic
1009260092 6:61475208-61475230 TTGGAGTTCATTGAGGGCAATGG + Intergenic
1010285528 6:74073503-74073525 AAGCATTTCCATGGGGGCAAAGG + Intergenic
1012814808 6:104009843-104009865 TTGCAGTTACTTGGTGCCAAAGG - Intergenic
1016585027 6:145674391-145674413 CTGCAGTTCCTTGGGGGCAATGG + Intronic
1016875753 6:148863536-148863558 ATGCAGCTCCTTGGTAGCAACGG - Intronic
1018219383 6:161563044-161563066 CTTCACCTCCTTGGGGGCACTGG + Intronic
1019665431 7:2249844-2249866 CTGCAGCTCCCTGCGGGCAGAGG - Exonic
1020361293 7:7329525-7329547 CAGCAGTGCCTGGGGGACAAAGG - Intergenic
1022187382 7:27983051-27983073 ATGCAGCTCCTTGGCAGCAACGG + Intronic
1022474148 7:30699458-30699480 CTGCGGGTCCCTGGGGGTAAGGG + Intronic
1022510623 7:30932957-30932979 CTGCAGTGGCTCGGGAGCAAGGG - Intergenic
1022976057 7:35557873-35557895 GTGGAGTTCCTAGGGGGCATTGG + Intergenic
1023351313 7:39322822-39322844 CTGCAGTTAATTTGGGGGAATGG - Intronic
1023987570 7:45105678-45105700 CTGCAGCTCCTTGGAGGCCTTGG + Exonic
1024005068 7:45219399-45219421 GTGCAGCTCCTTGTGGGCACCGG + Intergenic
1026983006 7:74537676-74537698 CTGCAGTTCCCTGGGAGGGAGGG + Intronic
1027226177 7:76244956-76244978 CTGGAGTTCCCTGAGGGCAGGGG - Intronic
1027945842 7:84745025-84745047 CTGTAGTTCCATGGGGAAAATGG - Intergenic
1028102542 7:86839049-86839071 CTTCATTTCATTGGGGGCACAGG - Exonic
1028460355 7:91085286-91085308 ATTCAGTTCCTTGGGGGGTATGG + Intronic
1029260812 7:99301587-99301609 CTGCAGGTCCTGGGGGGCACAGG - Intergenic
1031274370 7:119699976-119699998 CTGTAATTCCTTGGGGAGAAAGG - Intergenic
1031899128 7:127391648-127391670 CTGAACTTCCTGGGGGGCACTGG + Intronic
1031979518 7:128115774-128115796 CTGTGGTCCCTTGGTGGCAATGG - Intergenic
1032795456 7:135272408-135272430 CTGCAGGGCCTTGGGGGCCATGG + Intergenic
1033416059 7:141162129-141162151 CTGCAGTTCCTGTGGGGAAACGG - Intronic
1034963931 7:155379895-155379917 CTGCAGTTCCCGGGTGGCCAAGG - Intergenic
1035163398 7:156967921-156967943 CTGGAGCGCCTGGGGGGCAAAGG + Intronic
1036955761 8:13186687-13186709 CTGCAGCTCCTTGCCAGCAACGG - Intronic
1039347808 8:36726850-36726872 TTGCAGCTCCTTGGCAGCAAGGG + Intergenic
1039770984 8:40686548-40686570 CTGCAGCTTCCTGGGGTCAAAGG - Intronic
1041058107 8:54008531-54008553 CCCCAGTTACTTGGGGGTAAGGG + Intronic
1042540920 8:69906291-69906313 CTGCTGTTCCTTGCAGGGAATGG - Intergenic
1044073856 8:87794239-87794261 CTGCAGTTCCTTGCCAGCAATGG + Intergenic
1044147292 8:88732929-88732951 CACCAGTTCCTTGTGGGTAATGG - Intergenic
1044678711 8:94755529-94755551 CTGCAGCTTCTTGGGGGCAGCGG + Intronic
1045243395 8:100422090-100422112 CAGCAGTTCCTTGTTGGGAAGGG + Intergenic
1046909106 8:119606368-119606390 CAGCAGTTTCAGGGGGGCAAAGG + Intronic
1047897009 8:129377507-129377529 CTGCAGTTTCTTTGGGTCAGGGG - Intergenic
1047928460 8:129703208-129703230 ATGGAGTTCTTTGGGGCCAAGGG - Intergenic
1047976149 8:130132665-130132687 ATGCAGTTCCTTCAGGGCAGGGG + Intronic
1050358311 9:4804218-4804240 CAGCAGTTCCTTGGGACCCAGGG + Intronic
1053299168 9:36936500-36936522 CTGCACTCCCTTGGAGGTAATGG - Intronic
1054804376 9:69383825-69383847 CTGCTGTTCTCTGGGGGCAGGGG - Intronic
1059224631 9:112660131-112660153 CTGGAGCTCCTTGGAGGCAGGGG + Exonic
1060925707 9:127453915-127453937 ATGGAGTTCCATGGGGGCAGGGG - Intronic
1061132969 9:128718536-128718558 CTTCAGGTCCCTGAGGGCAAGGG - Exonic
1061194649 9:129101060-129101082 CTGCTGGTACTTGGGGGCACAGG + Intronic
1062225081 9:135445690-135445712 CTGAAGATGCTTGGTGGCAATGG + Intergenic
1185906413 X:3937879-3937901 TTGAGGTTCCTTGGGGGCAGCGG - Intergenic
1186283794 X:8022715-8022737 CTGCAACTCCTTGAGGTCAAGGG - Intergenic
1186722599 X:12321941-12321963 CTGCAGAACTTAGGGGGCAAAGG - Intronic
1186918964 X:14256451-14256473 CTGAAGTTCCTTGAAGGCAGAGG + Intergenic
1188792637 X:34423210-34423232 CTGTACTTCTTTGGGGTCAATGG - Intergenic
1189943820 X:46156315-46156337 ATGCAGTTCCATGGCAGCAAAGG + Intergenic
1191267216 X:58409934-58409956 TTGCAGCTCCTTGAGGCCAATGG - Intergenic
1193468286 X:81872316-81872338 CTGGAGTTCCTGGATGGCAATGG + Intergenic
1195754086 X:108183810-108183832 CAGAAGTTCCTTGGGGCCCAAGG + Intronic
1196022939 X:111009281-111009303 CTCCTGCTCTTTGGGGGCAAAGG + Intronic
1197107335 X:122731978-122732000 CTGGAGGTCCTGGGGGGAAAGGG + Intergenic
1199245948 X:145604403-145604425 CTGCTGTTTCTTGGGGGTAGTGG - Intergenic
1200179844 X:154143646-154143668 CTACAGCTCATGGGGGGCAAGGG + Intergenic
1200746712 Y:6910308-6910330 CGGGAGTTCCGTGGGGGCAGAGG + Intergenic
1201442326 Y:14021759-14021781 CTGCAACTCCTTGAGGTCAAGGG + Intergenic