ID: 1016585697

View in Genome Browser
Species Human (GRCh38)
Location 6:145682037-145682059
Sequence CTTTATTAGCAGAGTGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016585697_1016585702 7 Left 1016585697 6:145682037-145682059 CCGTTTTCACTCTGCTAATAAAG No data
Right 1016585702 6:145682067-145682089 CAAGACTGGGTAACGTTTACAGG 0: 1
1: 0
2: 7
3: 176
4: 1835
1016585697_1016585705 22 Left 1016585697 6:145682037-145682059 CCGTTTTCACTCTGCTAATAAAG No data
Right 1016585705 6:145682082-145682104 TTTACAGGAAGGAGGTTTAATGG No data
1016585697_1016585699 -6 Left 1016585697 6:145682037-145682059 CCGTTTTCACTCTGCTAATAAAG No data
Right 1016585699 6:145682054-145682076 ATAAAGACATACCCAAGACTGGG No data
1016585697_1016585698 -7 Left 1016585697 6:145682037-145682059 CCGTTTTCACTCTGCTAATAAAG No data
Right 1016585698 6:145682053-145682075 AATAAAGACATACCCAAGACTGG 0: 851
1: 2918
2: 5260
3: 7049
4: 8377
1016585697_1016585703 11 Left 1016585697 6:145682037-145682059 CCGTTTTCACTCTGCTAATAAAG No data
Right 1016585703 6:145682071-145682093 ACTGGGTAACGTTTACAGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 257
1016585697_1016585704 14 Left 1016585697 6:145682037-145682059 CCGTTTTCACTCTGCTAATAAAG No data
Right 1016585704 6:145682074-145682096 GGGTAACGTTTACAGGAAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016585697 Original CRISPR CTTTATTAGCAGAGTGAAAA CGG (reversed) Intronic
No off target data available for this crispr