ID: 1016588389

View in Genome Browser
Species Human (GRCh38)
Location 6:145715716-145715738
Sequence GTGAACTGCACTTGGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016588383_1016588389 27 Left 1016588383 6:145715666-145715688 CCTGTCAGATCAGCAGCACAGTA 0: 1
1: 3
2: 6
3: 56
4: 549
Right 1016588389 6:145715716-145715738 GTGAACTGCACTTGGGAGACAGG 0: 1
1: 1
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016588389 Original CRISPR GTGAACTGCACTTGGGAGAC AGG Intronic
900538154 1:3189117-3189139 GTTCACGGCACTTGGAAGACAGG - Intronic
903810442 1:26032264-26032286 GTAAACTGCACATGGGAGAAGGG - Intronic
905671242 1:39791655-39791677 CTGAACTGCCCTTGGGAGGGAGG - Intergenic
907498049 1:54858206-54858228 GAGAACTGCCCTTGGCAGAAGGG + Intronic
908761165 1:67513165-67513187 GGCAGCTGCACTTGGGAGCCAGG + Intergenic
909156984 1:72090866-72090888 CTTAACAGCACTTTGGAGACTGG - Intronic
909745870 1:79096431-79096453 GTCCACTGCTCTTGGGAGGCTGG - Intergenic
911356090 1:96822502-96822524 GTAAACTGGACTTAGGAGAAGGG + Intronic
913384958 1:118249522-118249544 GGGTACTGCTCTTGGGTGACAGG + Intergenic
915849850 1:159309776-159309798 GTGAAGAGCACTGGGGAGAAAGG - Intergenic
921174543 1:212582760-212582782 GAGACCTGCACTTAGGAGAAAGG + Intronic
1068484779 10:57643813-57643835 GAGAACTGCACTGGGGAGTTAGG + Intergenic
1069714064 10:70509412-70509434 GTGAAATGCACTTGGTAAAGTGG + Intronic
1069942708 10:71965885-71965907 GTGGGCTGGCCTTGGGAGACTGG + Intronic
1075139120 10:119815774-119815796 GTGGTCTGCTCTTTGGAGACAGG + Intronic
1077278556 11:1730387-1730409 GAGATGTGCTCTTGGGAGACTGG - Intergenic
1077534018 11:3110431-3110453 GTGCAATGCATTTGGGAGTCAGG + Intronic
1078241446 11:9534368-9534390 AGGACGTGCACTTGGGAGACAGG - Intergenic
1079460696 11:20675510-20675532 GTGAAAGGCACTTGGGCGACAGG + Intronic
1080029289 11:27643956-27643978 GTGAACTGCAGTGGGTACACAGG + Intergenic
1080993355 11:37569273-37569295 GTCAAGTGCACATGTGAGACTGG + Intergenic
1084272553 11:68036949-68036971 GTGGATGGCTCTTGGGAGACAGG - Intergenic
1091223394 11:133944112-133944134 GTGAGATGCAGTTGGGAGAAGGG + Intronic
1092054866 12:5500455-5500477 GTGACATGCACTTGGCACACAGG + Intronic
1092189149 12:6505360-6505382 GTAAACTGCATATGGCAGACCGG - Intronic
1093104126 12:15065699-15065721 GTGCAGACCACTTGGGAGACAGG - Intergenic
1093710796 12:22327777-22327799 ATGAACTGTACTTGATAGACAGG - Intronic
1094092089 12:26661702-26661724 GAGAAATACACTTGTGAGACTGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1097643573 12:62209705-62209727 TTTAACTGCACTTTGAAGACTGG + Intronic
1103850792 12:123931853-123931875 GTAATCTGCACATGAGAGACAGG - Intronic
1107327529 13:39260942-39260964 GTGATGTGCACTTGGGAGAAGGG + Intergenic
1108452870 13:50585005-50585027 ATAAACTGGGCTTGGGAGACAGG + Intronic
1110154119 13:72293308-72293330 GTGAACTGTGCTTGGGACAGAGG + Intergenic
1110772211 13:79362649-79362671 GTGAACCAGACTTGGGAGACAGG - Intronic
1111479772 13:88809718-88809740 GTGAACTGTCCTGGGGAAACTGG + Intergenic
1112262016 13:97885676-97885698 GTGAAGTGCAGTGGGGAAACTGG + Intergenic
1112642789 13:101295742-101295764 GTGAACTACACTGGGTAGAAAGG + Intronic
1117511206 14:56453247-56453269 CTGAACTGCTCTTGGGAGCTGGG + Intergenic
1120003257 14:79327596-79327618 CTGAACTGCACTGAGGAGAAGGG - Intronic
1120180015 14:81333682-81333704 TTGAGCTTCACTTGGGATACTGG + Intronic
1125903658 15:43371010-43371032 GGGAGCTGTACTTGGGAGGCTGG - Intronic
1129603596 15:77014045-77014067 CTGAACTGCCCCTGGGTGACAGG + Intronic
1130211817 15:81930887-81930909 GTGAACTGCACGTGGGAGACAGG + Intergenic
1141941603 16:87279592-87279614 GTGAACTGCACTTCTGTGCCAGG + Intronic
1143243435 17:5463528-5463550 GAGAACTGAACTTGGGAAGCTGG - Exonic
1144487312 17:15677651-15677673 GTGAACTTCACTAGGAAGAATGG - Intronic
1144913721 17:18704667-18704689 GTGAACTTCACTAGGAAGAATGG + Intronic
1146634844 17:34496305-34496327 TTGCACTTCACTTGGCAGACAGG + Intergenic
1147119423 17:38327162-38327184 GAGATCTGCCCTTGGGAGGCGGG - Exonic
1153829787 18:8912029-8912051 GTGAGCTGCACTTAGGAAAAGGG - Intergenic
1156050358 18:32925446-32925468 AAGAACGGCAGTTGGGAGACAGG + Intergenic
1158856969 18:61552588-61552610 GTGAATTTTACCTGGGAGACTGG - Intronic
1158957206 18:62551560-62551582 ATGAACTGTGCTTGGAAGACAGG + Intronic
1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG + Intronic
1161272008 19:3394998-3395020 GAGAACCCAACTTGGGAGACTGG - Intronic
1164963909 19:32462593-32462615 GTGAGCCACACCTGGGAGACGGG + Intronic
926699561 2:15794457-15794479 TTGAGCTGGACTTGGTAGACTGG + Intergenic
927111781 2:19868990-19869012 GGGAACTCCACGTGGGAAACGGG - Intergenic
932304741 2:70694057-70694079 GTGCACTGCACAAGGGAGCCTGG - Intronic
933586434 2:84184660-84184682 GTGAACTGGATTTGTGAGATTGG + Intergenic
935150283 2:100427763-100427785 GTGAACAGCACCCGCGAGACAGG + Intergenic
937127034 2:119481579-119481601 GTGAATTGCTCCTGGGAGCCAGG - Intronic
938008852 2:127812137-127812159 GTGATGGGTACTTGGGAGACTGG + Intergenic
939138146 2:138321548-138321570 GTGAACTGCACATGTGAAAAAGG - Intergenic
943256724 2:185602912-185602934 GTGAACTGCACATGTGAGGGAGG + Intergenic
944022327 2:195121422-195121444 GTGCACTTCACTGGGGAGAATGG - Intergenic
946687460 2:222285060-222285082 GTGAACCTCAATTGGGAAACTGG + Intronic
1169104976 20:2987076-2987098 TTGCACTGGAGTTGGGAGACTGG - Intronic
1176517806 21:7799322-7799344 GAGAACTGCAGCTGGGAGAGTGG - Intergenic
1178296253 21:31412829-31412851 GTGAACTGCACATGCGAGCGAGG - Intronic
1178651834 21:34429335-34429357 GAGAACTGCAGCTGGGAGAGTGG - Intergenic
1179254828 21:39706599-39706621 GTCAAGTACACTTGGAAGACAGG + Intergenic
1180071918 21:45440879-45440901 GTGATCTGAACTTGGGAGCAGGG + Intronic
1180200291 21:46220011-46220033 GTCATCTCCACTTGGCAGACTGG + Intronic
1183200573 22:36383291-36383313 GAGCACTGGACTTGGGTGACTGG - Intronic
1183684221 22:39352121-39352143 GAGAACTACTCTTTGGAGACAGG - Intronic
1184361630 22:44022566-44022588 ATGTACTGCACTGGGGGGACTGG + Intronic
1184657315 22:45948319-45948341 GGGAACTGCACTTGGGTGGTGGG + Intronic
950428642 3:12938362-12938384 GTGGCCTGCACCAGGGAGACTGG + Intronic
951344305 3:21528091-21528113 GTGCAATGAACTTTGGAGACAGG - Intronic
951437665 3:22683751-22683773 GTGAGCAGCATTTGGGAGGCAGG - Intergenic
952338288 3:32423820-32423842 GTGACCTGCACCTGGGGGGCTGG - Intronic
952837931 3:37620243-37620265 GAGAACTGCCCTTGGGTGACAGG - Intronic
957764638 3:84607069-84607091 GTGATTTGCACTTCGGAGAATGG - Intergenic
960574706 3:119218325-119218347 CTGAACTGCAATTTGGAGACCGG - Intronic
961012440 3:123445424-123445446 GTGAACCAGACTTGGGACACAGG - Intronic
961436446 3:126921758-126921780 TTCACCTGCACTTGGAAGACAGG + Intronic
963688589 3:148470248-148470270 GTGAACTTGACTTGGGTCACAGG - Intergenic
964226437 3:154408515-154408537 GTGGGCTGCATTTGGGAGAGGGG + Intronic
967079243 3:186033709-186033731 GGGAAGTGCTCTTAGGAGACAGG - Intergenic
968432726 4:568251-568273 GTGACATGCACTGGGGAGGCAGG - Intergenic
968462762 4:733508-733530 GTGCCCTGCACATGGGAGCCTGG + Intronic
968483828 4:849232-849254 GTGAACGGCACCTGGGCGAGTGG + Intergenic
971479405 4:27100881-27100903 CTGATCTGCAGTTGGGAAACAGG - Intergenic
973251786 4:48068324-48068346 CTGAACTGAGCTTGGGAGCCTGG - Intronic
973330601 4:48907110-48907132 GTGACCTGCACTTCACAGACGGG + Intergenic
973814909 4:54610739-54610761 GTGCACTGCACTTTGCACACCGG - Intergenic
975861874 4:78686122-78686144 GGGAACTGCCCTTGGGCTACTGG - Intergenic
976466409 4:85374238-85374260 ATGAATTGCACTAGGGAGAATGG - Intergenic
981671066 4:147287521-147287543 TTGAAATGCACCTGGGAGAGCGG - Intergenic
984502941 4:180579532-180579554 GTGAGCTGCATTTGTGACACTGG - Intergenic
985028945 4:185769119-185769141 GTCAAAGGCACATGGGAGACTGG + Intronic
988615677 5:32772480-32772502 TTGAACTGCACTTGTCATACTGG + Intronic
992859464 5:80896303-80896325 GGGATCTGCAATTGGGAAACGGG - Intergenic
993225580 5:85164906-85164928 GTGTACTGCAGGTGAGAGACAGG + Intergenic
996164572 5:120209361-120209383 GTGATCTGCACTTCAGAGCCTGG + Intergenic
997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG + Intronic
998151116 5:139758108-139758130 CTGCCCTGCACTGGGGAGACAGG + Intergenic
1002035580 5:176466848-176466870 GTAAAATGCACAGGGGAGACTGG - Intronic
1003770442 6:9293111-9293133 GTGAACTGCACTTAAGACATTGG + Intergenic
1011397841 6:86928835-86928857 GTGGACTGCACGTGGGAGGAAGG - Intergenic
1015718166 6:136213371-136213393 CTGTCCTCCACTTGGGAGACTGG - Intergenic
1016563421 6:145423802-145423824 TTAATCTCCACTTGGGAGACTGG - Intergenic
1016588389 6:145715716-145715738 GTGAACTGCACTTGGGAGACAGG + Intronic
1022443953 7:30454973-30454995 CTGGGCTGCACTTGGGAGACAGG + Intronic
1025955150 7:66177069-66177091 GTGTCCTGCACTTGGAAGGCTGG - Intergenic
1026348904 7:69498561-69498583 GTGAACAGGACTTGGCAGAGAGG + Intergenic
1026828669 7:73598822-73598844 CTGAACTGCACCTGGGGGCCAGG + Intronic
1029118587 7:98251666-98251688 GTGCTGTGCACTTGGGTGACAGG + Intronic
1029155656 7:98515810-98515832 CTGACCTGCACTTGTGAGATAGG - Intergenic
1032391399 7:131557102-131557124 GTGAATTGCACTTGGCAGGTGGG - Intronic
1034681993 7:152935938-152935960 GTGTACTGAGCTTGGGAGAGCGG + Intergenic
1037086155 8:14853357-14853379 GGGAACTGCATTTGGTGGACTGG - Intronic
1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG + Intergenic
1041103283 8:54417919-54417941 GTGGACTGCAGCTGGGACACAGG - Intergenic
1043027121 8:75084073-75084095 GTGAAATGCACTGGACAGACAGG + Intergenic
1043154521 8:76761075-76761097 GTTAACTGAAATTGGGATACAGG - Intronic
1045359035 8:101415017-101415039 TTGAGCTGCACTTGGAAGAATGG + Intergenic
1045778593 8:105836517-105836539 GTGAACTTCACTTGGTATAATGG - Intergenic
1047469982 8:125161137-125161159 GTGAACTGTCCTTGGGAGAATGG + Intronic
1048873777 8:138820843-138820865 GTGCTCTGCACTGGGGACACCGG - Intronic
1055949093 9:81714164-81714186 CTGCACTGCACCTGGGTGACAGG - Intergenic
1056362472 9:85872800-85872822 GGGAACTGTATTTTGGAGACTGG - Intergenic
1056379716 9:86046412-86046434 GTGCACGGCACCTGGGAGGCGGG - Intronic
1058628724 9:106963180-106963202 GTTAACAGCACTTGAGAAACAGG + Intronic
1058996055 9:110299751-110299773 GAGAACTGTGCTTGGGAGCCAGG + Intergenic
1059799882 9:117739568-117739590 TTGAACTGCAGTTTGGACACAGG - Intergenic
1060992129 9:127855147-127855169 GTCAACTGCACTTAGTAGGCCGG - Intergenic
1186340117 X:8636001-8636023 CTGACCTTCACTGGGGAGACGGG - Intronic
1187501306 X:19841232-19841254 GTGAACTGGTCCTAGGAGACAGG - Intronic
1189443847 X:41062235-41062257 GTGATCTGCATTTGGTAGCCAGG - Intergenic
1189856641 X:45230416-45230438 TTGAGCTCCACTTGGGACACGGG + Intergenic
1196174535 X:112626494-112626516 GAGAACAGTACTTGGGAGTCAGG - Intergenic
1197751246 X:129965117-129965139 CTCAGCAGCACTTGGGAGACTGG - Intergenic
1202274214 Y:23098814-23098836 GTGAAGTACACTTGGAAGAGGGG - Intergenic
1202291812 Y:23321863-23321885 GTGAAGTACACTTGGAAGAGGGG + Intergenic