ID: 1016589409

View in Genome Browser
Species Human (GRCh38)
Location 6:145728320-145728342
Sequence CAGAGGAAGCAGGAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1272
Summary {0: 1, 1: 0, 2: 8, 3: 126, 4: 1137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016589409 Original CRISPR CAGAGGAAGCAGGAGGATGA AGG Intronic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900803970 1:4755415-4755437 CAGAGCCAGCAGGAGGGAGACGG - Intronic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901016070 1:6231578-6231600 CAGAGGCAGAAACAGGATGAAGG + Intronic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901300777 1:8198703-8198725 AAGAGGAAGAAGGAGGAGAAGGG - Intergenic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901863370 1:12088758-12088780 AACAGGAAGGAGGAGGAGGAGGG + Intronic
902069838 1:13724833-13724855 AAAAGGAAGGAGGAGGAAGAGGG + Intronic
902099208 1:13971859-13971881 TGGAGGAAGCAGGAGCAAGAGGG - Intergenic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902333902 1:15744075-15744097 CACAGGAAGCCGGAGCCTGAAGG - Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902847577 1:19123973-19123995 CACTGGCAGCAGGAGGAAGAAGG + Intronic
903053134 1:20616401-20616423 GGCAGGAAGCAGGAGGAAGATGG - Intronic
903302060 1:22386184-22386206 CAGAGGAGCCCAGAGGATGAGGG - Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903705129 1:25280029-25280051 CAGGAGAAGTGGGAGGATGAGGG + Intronic
903804189 1:25992509-25992531 CAGAGTAAGTATGATGATGATGG - Intronic
903828896 1:26163271-26163293 CAAAGGAAGGAGGTGCATGAAGG - Intergenic
903857771 1:26346716-26346738 CAGAGGAATAAGAAAGATGAGGG + Intronic
903931375 1:26864241-26864263 CAGAGGCAGCAGGGGCAGGAGGG - Exonic
903989199 1:27253435-27253457 AAGAGGAAGGAGGAGGAAGGAGG - Intronic
904020928 1:27464594-27464616 CAGAGGACCCAGGTGTATGAGGG - Intronic
904371521 1:30050473-30050495 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904819805 1:33234631-33234653 GAGAGGAAGCAGGAGGAACAGGG + Intergenic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905118970 1:35667100-35667122 CAGAGGAGGCAAGAGGAAGAAGG - Intergenic
906180877 1:43817733-43817755 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
906528651 1:46511001-46511023 CAGAAGCAGAAGGAGGCTGAGGG + Exonic
906531048 1:46524250-46524272 CAGAGGCATCAAGAGGAGGAGGG - Intergenic
906741581 1:48190137-48190159 AGGAGGAAGCTGGAGGAAGAAGG + Intergenic
906758669 1:48348853-48348875 CAAAGAAGCCAGGAGGATGAAGG - Intronic
907279115 1:53333943-53333965 CAGAGGAAAGGAGAGGATGAAGG + Intergenic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
907472594 1:54683671-54683693 CAAAGCAAGCAGGAGGACCATGG - Intronic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
909297533 1:73969816-73969838 AAGATGAAGCAGGAACATGAAGG + Intergenic
909416783 1:75415625-75415647 CAGAGGAAGCAGGAAAATGTGGG + Intronic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
910146386 1:84085521-84085543 CACAGGAAGCAGCAAGATGAGGG + Intronic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912471497 1:109910280-109910302 CAGAGGAAGAAGGGGGCTGCCGG + Intronic
912708119 1:111929847-111929869 CAAAGGAAGGGGGAGCATGATGG - Intronic
912778495 1:112522576-112522598 CACAGGCAGCAGGAGGTTGGGGG + Exonic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
913045341 1:115069188-115069210 AAGAGCAAGCAGGAGGATTCAGG + Intronic
913084624 1:115425343-115425365 CAGAGGAAGCAGGACATTAAAGG + Intergenic
913124432 1:115772162-115772184 CAGAGGATGCTGGAGGCTCATGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915581633 1:156816424-156816446 AGGAGGGAGCAGGAGGATGAAGG - Intronic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
917728139 1:177847205-177847227 CAGAGGAAGAAAGGGGCTGAGGG - Intergenic
917729284 1:177858164-177858186 CCGAGGAAGATGGAGGGTGAAGG + Intergenic
917963576 1:180164912-180164934 GAGAGGAAGCAGGAGGGGGTTGG + Intronic
917981619 1:180273014-180273036 TAAAGGGAGCAGGAAGATGAAGG - Intronic
918095031 1:181327344-181327366 CAGAGAAAGCAGGGAGTTGACGG + Intergenic
918309472 1:183275490-183275512 CAGAGGCAGCAGAAGGATTTGGG - Intronic
918508864 1:185288310-185288332 CTGAGGCAGCAGGATCATGAAGG - Intronic
919071185 1:192756947-192756969 CAAAGGAAGCAGGAAGAAGATGG - Intergenic
919316693 1:195979748-195979770 CAGAGCAAGCAAGAGAGTGATGG - Intergenic
919611999 1:199756946-199756968 CAAACAAAGCAGGAGGAAGAAGG - Intergenic
919731318 1:200915338-200915360 GGGAGGATGCAGGAGGCTGAAGG + Intronic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920529604 1:206692388-206692410 CCAAGGAAGCAGGAGGAAAAGGG + Intronic
920825915 1:209424115-209424137 TAGAGGAACCAGGAGAGTGAAGG + Intergenic
921361009 1:214331136-214331158 AAGAGGGAGCAGGAGAAGGATGG + Intronic
922014526 1:221631599-221631621 GGGAGGAAGCAGGAGTGTGAAGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923079577 1:230640985-230641007 CAGAGGAGACAGGTTGATGATGG + Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923719682 1:236456251-236456273 CAGAGGAATCAGGGAGATGGAGG - Intronic
923925750 1:238625459-238625481 CAGAGGAAGTAATAGGATGATGG + Intergenic
924167185 1:241296170-241296192 GAGAGGGAGGAGGAGGAAGAAGG + Intronic
924287337 1:242501447-242501469 CTAAGGAAGGAGGAGGGTGAAGG - Intronic
924361569 1:243247036-243247058 TTGAGGAAGCAGGAGGGTGGGGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924680341 1:246224626-246224648 GAAAGGAAGGAGGAGGAGGAAGG + Intronic
924806444 1:247365456-247365478 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063623799 10:7671125-7671147 CAGAGGAAGGAGGGGGAACAAGG + Intergenic
1064376542 10:14801686-14801708 CAGAGGATGTAGGGGGATGTAGG - Intergenic
1064815506 10:19257297-19257319 CAGATGACCCAGGAGGATGAGGG + Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065002227 10:21347499-21347521 CAAAGGAAGCAAGAGAAGGAGGG + Intergenic
1065325407 10:24546180-24546202 CGGAGGAGGCAGGAGAAGGAGGG - Exonic
1065679186 10:28211792-28211814 CAGAGGGAGCAAGAAGAAGAGGG + Intronic
1066215830 10:33286403-33286425 CAGATGTAGGAGGAGGATGTAGG - Intronic
1066544424 10:36483682-36483704 CAAAGGAAACAGGATGATAAAGG + Intergenic
1066546652 10:36507463-36507485 CAGAGGAAGAATGAGGTTGGGGG - Intergenic
1066792445 10:39080803-39080825 TAGGGGTTGCAGGAGGATGAAGG + Intergenic
1067048262 10:42997940-42997962 CAGCAGAAGCTGGAGGATGTGGG + Intergenic
1067344775 10:45429191-45429213 GAGATGAGGCAGGAGGAAGAGGG + Intronic
1067375796 10:45727074-45727096 CGGAGGAAGCTGGAGGATAGGGG - Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067557812 10:47284871-47284893 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557818 10:47284891-47284913 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067775489 10:49161964-49161986 TAGAGGAAGCAAGTGGGTGAGGG - Intronic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1067883506 10:50067762-50067784 CGGAGGAAGCTGGAGGATAGGGG - Intergenic
1068022325 10:51600949-51600971 AAGATGAAGAAGGAGGAAGAAGG + Intronic
1068264468 10:54628245-54628267 GAGAAGAAGCAGGAAGATGTAGG + Intronic
1068322431 10:55437187-55437209 CAGAGGAAGCAGGAGACAAAAGG + Intronic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1069280091 10:66644910-66644932 CTGAGCTAGCAGGAGGATGTGGG - Intronic
1069550469 10:69360576-69360598 CAGAGGAAGCAGGGAAATCACGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069718514 10:70535570-70535592 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070368277 10:75757290-75757312 CAGGGGAAGAAGGAGGATTTAGG + Intronic
1070389416 10:75956302-75956324 GAGAACAAGCTGGAGGATGAGGG + Intronic
1070421444 10:76241611-76241633 CAGCGGAAGTGGGAGGCTGAGGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070448697 10:76535316-76535338 AAGAGGAAGGCAGAGGATGAAGG + Intronic
1070490524 10:76971627-76971649 CAGAGGAAGCAGGTGGTACAGGG - Intronic
1071456497 10:85855290-85855312 AGGAGGCAGCAGGAGGCTGAGGG + Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071604104 10:86972724-86972746 CCGAGGCAGCAGGAGCATGATGG - Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072899553 10:99394959-99394981 CAAAGCAAACAGGAGGATCAGGG + Intergenic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073429407 10:103476557-103476579 CAGAGGAAGGAGGGGGGTCAAGG + Intronic
1073733215 10:106315759-106315781 CAGAGGAGCCAGGATGATGCAGG + Intergenic
1073960840 10:108925524-108925546 CAGAGAAAGCAGGATGGTGTTGG + Intergenic
1074367625 10:112872170-112872192 CACAGGAATCAGGTTGATGAAGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074820949 10:117177978-117178000 AAGTGGAAGCAAGAGAATGACGG + Intergenic
1075208245 10:120465498-120465520 CAGAGGAGGCAGGAGCATTTAGG + Intronic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075328350 10:121553252-121553274 AAGAGGAAGGAGGAGAAAGAAGG + Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075762917 10:124870310-124870332 GAGAGGAAGCGGGAGGAGCAGGG + Intergenic
1075805968 10:125189101-125189123 CAGAGGATGCAGGGAGATGATGG - Intergenic
1075887456 10:125913738-125913760 CAGGTGAAGCAGGAGGCTCAGGG - Intronic
1076468662 10:130703342-130703364 CAGTTGATGCAGGTGGATGAGGG - Intergenic
1076897907 10:133323142-133323164 GAGAGGAAGCAGGAGAAGGATGG - Intronic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1077015992 11:399409-399431 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077016021 11:399482-399504 CAGAGGGGGCAGGTGGAGGAGGG - Intronic
1077535505 11:3122199-3122221 GAGAGGAAGTAGGAGGAAGTAGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078677726 11:13440039-13440061 CAGAGGAATCTTGAAGATGATGG - Intronic
1078848573 11:15143397-15143419 CAGAGGAAGGAGTACTATGAAGG + Intronic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1080484066 11:32686118-32686140 CAGATGAAAGAGGATGATGAAGG + Intronic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080947926 11:36995889-36995911 GAGAGGAGTGAGGAGGATGAGGG - Intergenic
1081540546 11:44031571-44031593 GAGAGGGAGCAGGAGGAGGTGGG + Intergenic
1081606451 11:44530095-44530117 TAGAGGAAGGATGAGGATGATGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083514380 11:63243047-63243069 CAGAGAAAGCAGGGGAGTGAGGG + Intronic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083712785 11:64559342-64559364 CAGAGGAGGCAGGAGGGAGACGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1084950740 11:72664077-72664099 CAAAGGAGGCAGGTGGGTGAGGG - Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1086221797 11:84454228-84454250 CAAAGGAAGGAGGAAGAAGAAGG + Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086598188 11:88600260-88600282 GAGAAGGAGCAGGAGGAAGAAGG - Intronic
1086720857 11:90119400-90119422 TAGAGGAAGAAGGAGGATGTTGG + Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086950043 11:92882601-92882623 CAGATGAAGCAGGACAAAGATGG - Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087142067 11:94774370-94774392 CACAGGAGGCAGGAGGAGGTGGG + Intronic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1088994459 11:114984640-114984662 CACAGGAAGATGGAGGAGGAGGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089421994 11:118338961-118338983 CAGAGGAAGGAAGGAGATGAAGG + Exonic
1089527446 11:119106806-119106828 AAGAGGAAGGAGGGTGATGATGG + Intronic
1090277884 11:125432385-125432407 GAAAGGAAGCTGGAGGCTGATGG - Exonic
1090359738 11:126163958-126163980 CAGAGGAAGCTAGAGTTTGAGGG - Intergenic
1090771000 11:129919865-129919887 CAGAAGAGGCAGGTGGGTGAGGG - Intronic
1090966433 11:131601267-131601289 CTGAGGCAGAAGGAGCATGATGG + Intronic
1091011122 11:132001569-132001591 GAGAGGAAGCAGGAGAGAGAGGG + Intronic
1091067043 11:132524363-132524385 CCCAGGAAGTAGGATGATGATGG - Intronic
1091074183 11:132599367-132599389 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074185 11:132599377-132599399 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074187 11:132599387-132599409 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074189 11:132599397-132599419 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074191 11:132599407-132599429 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091111616 11:132974232-132974254 GAGAGGTAGCTGGAAGATGAAGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091310764 11:134573706-134573728 CAGAGGAGGCAGGAAGGGGATGG + Intergenic
1091448908 12:560752-560774 CCGAGGAGGCAGGAGGTTCAGGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091880940 12:3977719-3977741 CTGAGGAAGCAGGAGAAACATGG + Intergenic
1092290014 12:7154543-7154565 AAGAGCAAGCCGGATGATGAGGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092976168 12:13746830-13746852 GAGAGAAAGCAGGAGAGTGAGGG - Intronic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093109488 12:15132143-15132165 AAGATGAACTAGGAGGATGAAGG + Intronic
1093118873 12:15244120-15244142 GAGAGGAAGCAGGTGCAAGAAGG - Intronic
1093508397 12:19896755-19896777 AGGAGGAAGAAGGAGGAAGAAGG - Intergenic
1093508399 12:19896765-19896787 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094166167 12:27446261-27446283 CAGAGGGAGCAGGAGGGGAAGGG + Intergenic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1094671574 12:32575383-32575405 CAGAGGAAGCAAGAGAGAGAAGG + Intronic
1095982353 12:47980673-47980695 AGGAGGAAGCAGGTGAATGAGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1097477653 12:60078608-60078630 GATAGGAAAGAGGAGGATGAGGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098331096 12:69354580-69354602 CAGAGGAGGGTGGAGGATAAGGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098519929 12:71423621-71423643 CAGTGTGAGCAAGAGGATGATGG - Intronic
1099133643 12:78865338-78865360 AAGAGGAAGCAAGAAGATGGGGG - Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100433115 12:94547894-94547916 CACAGGGAGTAGGAAGATGAAGG - Intergenic
1100535491 12:95505009-95505031 CAGATGAGGGAGGAGGATGGTGG - Intronic
1100576513 12:95896579-95896601 CGGAGGCAGCAGTAGAATGAAGG - Intronic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102224296 12:111217024-111217046 CACAGGAAACTGGAGGATTAGGG + Intronic
1102230367 12:111257636-111257658 AGGAGGAAGGAGGAGGAAGAGGG - Intronic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102792322 12:115657807-115657829 ACGAGGAAGAAGGAGGAGGAGGG - Intergenic
1102798911 12:115714528-115714550 CAGAGGAGGCAGGAAGAGAAAGG + Intergenic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102910342 12:116708807-116708829 CGGAGGGTGCAGGAGGAAGAAGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1103367015 12:120390772-120390794 GAAAGGAAGGAGGAGGAGGAAGG + Intergenic
1103367644 12:120394790-120394812 CAGAGGAAGCCGGAAGCTGGAGG - Intergenic
1103450110 12:121022724-121022746 CAGAGGACAAAGGATGATGAGGG - Intronic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1103615534 12:122149382-122149404 CAGAGGCAGCTGGAGCAGGATGG - Intergenic
1104373607 12:128245256-128245278 CAGAGGAGACAAGAGGATGTGGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104456019 12:128913132-128913154 GGGAGGAAGGAGGAGTATGAAGG - Intronic
1104820298 12:131673139-131673161 TGGATGAAGCAGGAGGATGAAGG + Intergenic
1104833711 12:131772975-131772997 GAGAGGAAGCAGCTGGATGTTGG - Intronic
1104861181 12:131924747-131924769 CAGAAGTACCAGGAGGATCACGG - Intergenic
1104948834 12:132429605-132429627 CAGAGGACGCAGGCTGCTGAGGG - Intergenic
1104964749 12:132503895-132503917 CAGTGGGGGCAGGAGGCTGAGGG - Intronic
1104993372 12:132639471-132639493 CAGATGAGGCATGAGGGTGAAGG - Intronic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106172048 13:27296695-27296717 CTCAGGGAGCAGGAGGATGCAGG - Intergenic
1106175984 13:27332090-27332112 CACAGGAATGAGGAGGAAGAGGG + Intergenic
1106514053 13:30437844-30437866 CACAGGAATCAAGAGGATGATGG - Intergenic
1106766823 13:32921871-32921893 GGGAGGAAGCAGGAGGAAGAGGG + Intergenic
1106845752 13:33736260-33736282 CAGAGGAAGCCGGTGATTGAGGG - Intergenic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107794331 13:44034460-44034482 GAGAGGGAGAAGGAGGAAGAAGG + Intergenic
1107999667 13:45894706-45894728 CAGAGGAAGATGGCGGAAGATGG - Intergenic
1108027265 13:46191094-46191116 CACAGGGAGCAGGAGAATGAAGG - Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108291034 13:48961370-48961392 GAGAAGAAGAAGGAGGAAGAGGG + Intergenic
1108700229 13:52937460-52937482 GAGATGAAGCAGGAGGTTGAGGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1110924799 13:81137991-81138013 CAGAGGAAGTGGGAGGGGGAAGG - Intergenic
1111057062 13:82964846-82964868 CTGAGGCAGAAGGAGGTTGAGGG + Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111335280 13:86813515-86813537 GAGAGGAAGCAAGAGGGAGATGG - Intergenic
1111566290 13:90021095-90021117 CACAGGTAGCATTAGGATGATGG - Intergenic
1111831735 13:93338855-93338877 CTGAGGGAGCAGGAAGATGGAGG - Intronic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113447411 13:110379910-110379932 GAGAGGAGGCAGGTGGAGGAGGG - Intronic
1113957718 13:114108157-114108179 CAGGGGATGACGGAGGATGATGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114429019 14:22644674-22644696 CAGAGGAAGAAGCAGGTTGATGG - Intergenic
1114537160 14:23430275-23430297 CCGAGGGAGCAGGACGAGGAGGG - Intronic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114782264 14:25550875-25550897 AAGAGGGAGGATGAGGATGAGGG + Intergenic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115892538 14:38047422-38047444 CAGAGGAAACAGGAAGAAGTTGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116572701 14:46537967-46537989 GAGAGAAAGCATGAGGTTGATGG - Intergenic
1117225723 14:53656770-53656792 CAGAGGAAGCAGGACTAGGTGGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117384730 14:55200115-55200137 AAGCTGAAGCAGGAGGATCAAGG - Intergenic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1118440337 14:65806196-65806218 ATGAGGGAGCAGGATGATGAGGG - Intergenic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118839970 14:69502621-69502643 AAGAAAAAGCAGGATGATGATGG + Intronic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119198306 14:72733589-72733611 GAGAGGACGCAGCAGGCTGATGG - Intronic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120746171 14:88153842-88153864 GAGAGGAGGCAGGAGCAGGAAGG + Intergenic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121055094 14:90845685-90845707 ACGAGGGGGCAGGAGGATGAAGG + Intergenic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121486672 14:94321678-94321700 CAGATGAGGCAGGGAGATGAGGG - Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121991545 14:98562527-98562549 CAGAGCAAGGAAGAGGCTGAAGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122196539 14:100091574-100091596 CAAAGGATGCAGGAAGAGGATGG - Intronic
1122464049 14:101918454-101918476 CAGAGGAGCGAGGGGGATGAAGG - Intronic
1122717778 14:103705829-103705851 CGGAGGACGCTGGAGAATGAGGG + Intronic
1122826696 14:104374148-104374170 AAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123004154 14:105313573-105313595 CGGAGGAAGCAGCGGCATGAGGG + Exonic
1123043541 14:105500243-105500265 CAGAGGCTGCAGGTGGAGGAGGG - Intergenic
1202870677 14_GL000225v1_random:160346-160368 CAGGTGAAGCAGGAGGCTCAGGG + Intergenic
1123796768 15:23780506-23780528 GAGTGGAAGCAGGAACATGATGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1124067732 15:26361675-26361697 CATAGGAAGCACGAGAGTGAGGG + Intergenic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1124232456 15:27957006-27957028 CAGAAGAAGCAGGAGCCTGGTGG - Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125536527 15:40443707-40443729 CAAAGGAAGCAGGAGGGAAAGGG - Intronic
1126065756 15:44825057-44825079 CTCAGGGAGGAGGAGGATGAAGG + Intergenic
1126094079 15:45075510-45075532 CTCAGGGAGGAGGAGGATGAAGG - Exonic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126674878 15:51152440-51152462 AAGAGGAAGAAGGAAGAAGAAGG + Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1127103249 15:55588247-55588269 CAGGGGAAGCAGGAGGCTCGCGG + Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127692284 15:61409125-61409147 AAAAAGAAGTAGGAGGATGAGGG + Intergenic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128701938 15:69811103-69811125 CAGAGGAGGCAGGGGAAGGAAGG - Intergenic
1129295826 15:74599526-74599548 CGGAGGAAGCAGGCTGAGGAGGG + Intronic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129450208 15:75647449-75647471 CGGAAAAGGCAGGAGGATGACGG + Intronic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1129718945 15:77867174-77867196 GAGGGGCAGCAGGAGGGTGAAGG - Intergenic
1130024119 15:80256447-80256469 CAGAGGCAGCAGGAGGTGCATGG - Intergenic
1130192421 15:81749804-81749826 CAGAGGAAGCAGGAGAGGAAAGG + Intergenic
1130266057 15:82404660-82404682 GAGAAGAAGTTGGAGGATGAAGG + Intergenic
1130459986 15:84153679-84153701 GAGGGGCAGCAGGAGGGTGAAGG + Intergenic
1130505958 15:84542214-84542236 GAGAAGAAGTTGGAGGATGAAGG - Intergenic
1130981364 15:88813918-88813940 CAGAGGGAGCTGGAGGGTCAGGG - Intronic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131612277 15:93977719-93977741 AGGAGGAAGCAGTAGGTTGAAGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1133036287 16:3036052-3036074 AGGAGGTAGCAGGAGAATGAGGG - Intronic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133392645 16:5422410-5422432 GAGAGGAAGGAGGAGGGAGAGGG + Intergenic
1133392793 16:5422914-5422936 AGGAGGGAGAAGGAGGATGAGGG + Intergenic
1133392853 16:5423089-5423111 AAGAGGAAGGAGGAGGGAGAGGG + Intergenic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133837663 16:9381084-9381106 CAGAGGAAGCAAGAGAGGGAGGG + Intergenic
1133850167 16:9495982-9496004 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1133929135 16:10217996-10218018 CAGTGGGAGCAGGAGGCTGGTGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134378447 16:13701574-13701596 CAGAAGAGGCAGGATCATGAAGG + Intergenic
1134800185 16:17077028-17077050 GAGAGGAAAGAGGTGGATGATGG - Intergenic
1134844553 16:17428937-17428959 CATAGGGATCAGGAGGATGCAGG + Intronic
1135231441 16:20711856-20711878 ACTAGGAAGCAGGAGGATGGAGG - Intronic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1137002192 16:35238928-35238950 CATATGATGAAGGAGGATGAAGG - Intergenic
1137324494 16:47420525-47420547 AAGAGGAAGCGTGAGGATCATGG + Intronic
1137502478 16:49022247-49022269 GAGAGGAAGCAGGAGGAAAAGGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137691519 16:50431201-50431223 CAGAGGGTTCAGGAGGATCAAGG + Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138499490 16:57430507-57430529 CAGAAGTGGGAGGAGGATGAGGG + Intronic
1139165771 16:64563404-64563426 AAGAGGAAGAAGGAGAGTGAGGG + Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139477508 16:67210016-67210038 GAGAGGAAGGAAGGGGATGATGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140530395 16:75660760-75660782 CAGAAGATGGGGGAGGATGAAGG + Intronic
1140536500 16:75714667-75714689 CAGAAGATGGGGGAGGATGAAGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141506561 16:84482103-84482125 CACAGGAAGCAGGGGGAAGCGGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141939605 16:87266030-87266052 CAGAGGAAGCAGGAGAGCCAGGG - Intronic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142274804 16:89112793-89112815 CAGATGAAGCAGGAGCAAGCGGG - Intronic
1142359513 16:89619613-89619635 CAGAGGGAGCAGGGGGCTGCAGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142887294 17:2920645-2920667 AGGAGGAAGCAGGCGGACGAGGG + Intronic
1142889898 17:2936469-2936491 GAGAGGAAGAGGGAGGAAGAAGG - Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143794687 17:9327206-9327228 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144615810 17:16770788-16770810 CAGAGGATGCTGAAGGATTAAGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144797614 17:17903016-17903038 CAGATGAGGCAGGTGGATGAAGG - Intronic
1144896893 17:18544883-18544905 CAGAGGATGCTGAAGGATTAAGG + Intergenic
1144961543 17:19046967-19046989 CAGAGGAAGCAGGAAGCTGTCGG - Exonic
1144973617 17:19127557-19127579 CAGAGGAAGCAGGAAGCTGTCGG + Exonic
1145135320 17:20399331-20399353 CAGAGGATGCTGAAGGATTAAGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146364516 17:32210688-32210710 CTGAGGGAGGAGGAGGAGGAGGG + Intronic
1146432861 17:32814492-32814514 GAGAGGAAGAAGGATAATGAAGG + Intronic
1146435215 17:32839594-32839616 CAGAGAAAGGCAGAGGATGAAGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146497209 17:33333788-33333810 GAGAGGAAAGAGGAGGATTATGG + Intronic
1146554505 17:33812178-33812200 CAGAGGGATCAGCAGGGTGACGG + Intronic
1146593249 17:34146957-34146979 GAGAGGCTGCAGCAGGATGAGGG - Intronic
1146638949 17:34525943-34525965 CAGAGGGGGCAGGAAGCTGAGGG + Intergenic
1146936110 17:36813574-36813596 CAGAGGAAGAAGGAGGAATGAGG + Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147476578 17:40717514-40717536 CAGAGGAACCAGGCTGGTGACGG - Intergenic
1147523033 17:41192781-41192803 CAGAGGACGCAGCAGTACGAAGG + Intronic
1147738724 17:42657941-42657963 CAGAGGAATCAGGAGAGGGAAGG - Intergenic
1148006770 17:44438569-44438591 AAGACCAAGCAGAAGGATGAAGG + Intronic
1148029376 17:44608985-44609007 CAAAGGGAGCAAGAGGAAGAAGG + Intergenic
1148512142 17:48180312-48180334 AAGAGGGAGAAGGAGGAGGAGGG + Intronic
1148559362 17:48597203-48597225 CAGAGGAGGGAGGAGGAATAAGG - Intronic
1148746130 17:49919577-49919599 CAGAGGAAGCAGGTGGAGCGTGG - Intergenic
1148846678 17:50533783-50533805 CAGAGGAGGGAGGAAGCTGAGGG - Intronic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1148997524 17:51724027-51724049 AATAGTAATCAGGAGGATGAGGG + Intronic
1149557997 17:57587977-57587999 ACGAGGAAGCAGGTGCATGAAGG + Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151045015 17:70909619-70909641 CAGGTGAAGCAGGAGGATTTAGG + Intergenic
1151752259 17:76046278-76046300 CAGAGGAAGCAGGGGGCGGGTGG + Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152022511 17:77787997-77788019 CTGAGGAAGCTGGTGGCTGAAGG + Intergenic
1152036599 17:77877141-77877163 CAAAGGGAGGAGGAGGTTGAGGG + Intergenic
1152324019 17:79625144-79625166 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152681421 17:81670302-81670324 CAGAGGAAGGGGGAGTCTGACGG + Exonic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153678333 18:7476186-7476208 CAGAGGGAGCAGGAAGGTGAGGG - Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155066550 18:22273801-22273823 AGGAGGAAGGAGGAGGATGGAGG - Intergenic
1155404999 18:25478119-25478141 CAGGGGAAGGAGGAGGTTTACGG - Intergenic
1156375973 18:36515616-36515638 CAGAAGCAGCAGGTGGTTGACGG - Intronic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157382017 18:47227145-47227167 AGGAGGAAGAAGGAGGAAGATGG - Intronic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1157856222 18:51108049-51108071 AGGAGGAAGCTGGAGGATCAGGG + Intergenic
1157981249 18:52383690-52383712 CAGAGAAACCAGGAAAATGAAGG - Intronic
1157993174 18:52521842-52521864 GAGAGGCAGTAGTAGGATGAGGG - Intronic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158471303 18:57739364-57739386 CAGTGGTAGCAGGAAGAGGAGGG - Intronic
1158509583 18:58078768-58078790 CCGAGGGAGGAGGAAGATGAAGG + Intronic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1158771291 18:60520606-60520628 CAGTGGAAACAGGAGCTTGAAGG + Intergenic
1158859486 18:61578514-61578536 CAGAAGCAGCATGCGGATGATGG + Intergenic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1159053395 18:63442559-63442581 TAAAGGAAGAAGGAGGAGGAGGG + Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159955499 18:74515851-74515873 CAGAGGCACCAGGAGTAAGAGGG - Intronic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160398345 18:78588652-78588674 CAGAGCAAGCTGGAGAATGAGGG + Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161067444 19:2245687-2245709 CAGAGGCTGCAGGTGGGTGAGGG - Intronic
1161588387 19:5117711-5117733 CACAGGGAGCAGGAGGTGGATGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161739513 19:6012007-6012029 CACAGACAGCATGAGGATGATGG - Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162784633 19:13026799-13026821 GAGAGGAAGAAGGAAAATGAAGG - Intronic
1162955077 19:14092888-14092910 GAGAGGGGGCAGGAGGGTGAAGG + Exonic
1163111907 19:15166439-15166461 CAGTGGGTGCAGGAGTATGAAGG - Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163127279 19:15251154-15251176 CACAGGCAGGAGGAGGATGGCGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164591989 19:29512351-29512373 GAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164864639 19:31594242-31594264 CAGAGGAAGAAGGAGGCACAGGG - Intergenic
1165416039 19:35694111-35694133 AAGAGGGAGGAGGAGGAGGAAGG - Intergenic
1165454578 19:35903321-35903343 AAGAGAAAGAAGGTGGATGAGGG - Intronic
1165468769 19:35990826-35990848 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468771 19:35990836-35990858 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468773 19:35990846-35990868 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468775 19:35990856-35990878 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165694034 19:37886730-37886752 GAAAGGAAGGAGGAGGAGGAAGG - Exonic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1166326857 19:42056394-42056416 CACAGGAAGCAGGGGGAAGAGGG + Intronic
1166864967 19:45830307-45830329 GAGAGGCAGCAGGGGGATGGGGG - Intronic
1166882073 19:45935758-45935780 CAAAGTAAGAAGGAGGATGTGGG + Exonic
1166960514 19:46493683-46493705 CGCAGGAAGCAGGAAGAAGAAGG - Exonic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1168025557 19:53641094-53641116 CAGAGGAAACAGGAGGGAAAAGG + Intergenic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
1168579693 19:57544509-57544531 GAGAGGATGCAGGAGGGTGGGGG + Exonic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925639138 2:5970880-5970902 CTGAGGGAGCAAGGGGATGAAGG - Intergenic
925744452 2:7032613-7032635 AAGAGGCAGCCGGAGGAAGACGG - Intronic
925862600 2:8194475-8194497 GAGAGGAGGGAGGAGGATGGTGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926104531 2:10142041-10142063 CAGAGGGAGCCAGAGGATGTGGG + Intronic
926248331 2:11137785-11137807 CAGTGGGAGCAGGAGGATATGGG + Intronic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928605565 2:32942528-32942550 GAGAGGAAGCAGGAGAGAGAGGG - Intergenic
928979060 2:37119429-37119451 TAGAGGAGGCAGGAGGAACAGGG + Intronic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929245496 2:39697737-39697759 CAGAGGAAGCAGGAGAACCCTGG + Intronic
929250084 2:39743654-39743676 GAGAGGAAGCAAGAGGGAGAAGG - Intronic
929920721 2:46169409-46169431 CAGAGGAACATGGAGGGTGAAGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930806671 2:55497264-55497286 CACAGATAGCAGGAGGAAGAGGG + Intergenic
931376389 2:61712179-61712201 CAGAGGAGAGAGGATGATGATGG - Intergenic
931801280 2:65760465-65760487 CAAAGGAAGAAGGAGTAGGAAGG + Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932208162 2:69902288-69902310 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
932331800 2:70901927-70901949 AAGAGGCAGCAGGAGGAAGCCGG - Intronic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
932539411 2:72636425-72636447 AAGAGGAGGGAGGAGGAAGAAGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
934103738 2:88677627-88677649 CTGAGGTAGCACGAGGCTGAAGG + Intergenic
934160440 2:89244531-89244553 CATAAGCAGCAGGAGAATGAGGG - Intergenic
934206837 2:89937907-89937929 CATAAGCAGCAGGAGAATGAGGG + Intergenic
934555014 2:95282479-95282501 GACAGTGAGCAGGAGGATGAGGG + Intronic
934658833 2:96132417-96132439 CACAGGAAGCAGGCAGGTGATGG + Intronic
934908958 2:98233003-98233025 CAGAGATAGCAGGAGCAAGAGGG - Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935129028 2:100247595-100247617 CAGAGGCAGGACGAGGATGCAGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936409083 2:112238091-112238113 TAGAGGGAGCTGGAGGATGGAGG - Intronic
936666185 2:114598454-114598476 CAGAGGTAGCAGGAAGTAGAAGG + Intronic
936923313 2:117711223-117711245 CAGAAGAAAGAGGAAGATGAGGG + Intergenic
937091505 2:119209406-119209428 CAGAGGAGGCAGGAGGGTTTAGG + Intergenic
937295666 2:120808389-120808411 GAGAGGTCACAGGAGGATGATGG - Intronic
937476315 2:122218465-122218487 CCCAGGAAGCCTGAGGATGACGG + Intergenic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
938081820 2:128374243-128374265 CAGAGGCAGCAGGAGCACCAAGG + Intergenic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938671963 2:133595359-133595381 AAGAAGAAGGGGGAGGATGAGGG - Intergenic
938794344 2:134705591-134705613 CAGAGGAAGCCGGGGTAGGAAGG - Intronic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939326207 2:140691999-140692021 CAGAGAAAGCAAGATGTTGATGG + Intronic
940013139 2:149075967-149075989 CTGATGAGGCAGGAGGCTGACGG + Intronic
940439136 2:153693632-153693654 AAGGGCAAGCAGGAGGATAAGGG + Intergenic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
942299380 2:174547335-174547357 AAGAGGGAGGAGGAGGAGGAGGG - Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942816700 2:180060867-180060889 TAGGGGTTGCAGGAGGATGAAGG - Intergenic
942940745 2:181613148-181613170 GAGGGGAAGCAAGGGGATGATGG - Intronic
944036238 2:195297872-195297894 CACAGTAAGCAAGAGGAAGAGGG + Intergenic
944046699 2:195419951-195419973 CAGAGGAGACAGGATAATGATGG - Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944398935 2:199303381-199303403 CGGAGGAAGAAGGAAGATGAAGG + Intronic
944770809 2:202912475-202912497 AGGAGGAGGCAGGAGGAAGACGG - Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
946046865 2:216828603-216828625 CAAAGGAAGCAGGTGGAGCAGGG + Intergenic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946714566 2:222539677-222539699 CAGAAACAGCAGGAGGAAGATGG + Intronic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
946924869 2:224616558-224616580 CAGAGGGAGTAGGGAGATGAGGG - Intergenic
947347534 2:229208775-229208797 CGGAGGAGGCAGGAGGAGAAAGG + Intronic
947389989 2:229628966-229628988 AAGAGGAAGGAGCAGGGTGAGGG - Intronic
947619507 2:231580593-231580615 AAGAGGGAGGAGGAGGAGGAGGG + Intergenic
947722314 2:232377732-232377754 AAGATGAAGCAGGAGGTAGAAGG + Intergenic
947726211 2:232402536-232402558 AAGATGAAGCAGGAGGTAGAGGG + Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948091955 2:235302235-235302257 AAGAGGAGGGAGGAGGAAGAGGG - Intergenic
948125419 2:235561468-235561490 CAGAGGAAGCAGGAGATAAAGGG - Intronic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
948675000 2:239591956-239591978 AAGAGGAAGCAGGGGGTTTAGGG + Intergenic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1168881461 20:1209642-1209664 CAGAGGGAGCATGTGGATCATGG + Intergenic
1169000333 20:2163631-2163653 CAGAGGAAGCAAGGGGAAGAAGG + Intronic
1169046992 20:2541024-2541046 CAGAGGAAACAGGGGATTGAGGG - Intronic
1169211672 20:3769155-3769177 CGGAGGAGGCAGGAGGGGGAAGG - Intergenic
1169276216 20:4235339-4235361 TAGAGGATGCAAGAGGATGCGGG - Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1171983914 20:31646086-31646108 GAGAGGAAGCAGGAGTAGGTTGG + Intergenic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172931492 20:38589336-38589358 CAGAGGCTGCAGGATGATGGGGG + Intergenic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173107593 20:40152338-40152360 CAGATGAAGCAGAAATATGAGGG + Intergenic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173596936 20:44264538-44264560 AAGAGGAAGCTGGAGAACGAGGG + Exonic
1173743471 20:45419046-45419068 CTGAGGAAGCAGGAAACTGAGGG - Intronic
1173875502 20:46368087-46368109 CAGAGGAAGCAGGAAGAGTCAGG - Intronic
1174544680 20:51316522-51316544 CAGAGGAAGGAGGGAGCTGAGGG + Intergenic
1174576468 20:51541443-51541465 TAGAGGGAGGAGGAGGAGGAGGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176112865 20:63418458-63418480 CCCAGGAAGCGTGAGGATGAAGG + Intronic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177555480 21:22682457-22682479 CAGAAGAAGAAGGAAAATGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178401694 21:32291799-32291821 CTGAGGCAGCAGGTGGATAATGG + Exonic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178643207 21:34363381-34363403 AAGAGGAAGAAGGAAGAAGAAGG - Intergenic
1178691869 21:34756477-34756499 TATGGGAAGCAGCAGGATGAAGG - Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1178832891 21:36071128-36071150 GAGAGGAAGCAGGAGCCTGCAGG - Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1178982124 21:37273518-37273540 AAGAGGGAGAAGGAGGAGGAGGG + Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179246072 21:39635272-39635294 TAGAGGAAATAGGAGGTTGAGGG + Intronic
1179320776 21:40289228-40289250 AAGAGCATGCAGGAAGATGAGGG + Intronic
1179346626 21:40564470-40564492 TAGAGGAAGGAGGAGGGTGGTGG - Intronic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180044981 21:45301159-45301181 CGGAGGAGGATGGAGGATGAGGG - Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181013022 22:20053334-20053356 GGGAGGATGCAGGAAGATGAGGG - Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1182517534 22:30867508-30867530 CAGAGAGATCAGGAGAATGAGGG - Intronic
1182598049 22:31437455-31437477 TAGAGGAAGCGGGAGGGTGGGGG - Intronic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1182946505 22:34327751-34327773 GAGAGGAAGCAAGAGCAAGACGG - Intergenic
1182986907 22:34728166-34728188 GAAAGGAAGAAGGAGGAGGAGGG + Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183355843 22:37358956-37358978 CATAGGAAGCAGGAGGACTGGGG + Intergenic
1183524199 22:38314173-38314195 CAGAGGAAGCAGGAACATGAGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183678929 22:39315538-39315560 CAGAGGAAGCAGGCGCATCTAGG + Exonic
1183699716 22:39444465-39444487 CAGAAGCAGCAGGAGAATCAGGG + Intergenic
1184278329 22:43423154-43423176 AAGAGGAAGCTGGAGGCTCAGGG + Intronic
1184327182 22:43797816-43797838 CAGAGGGAGCCGGGGGAGGATGG - Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185075037 22:48678427-48678449 CAGAGGAACCAGGAAGAGGTCGG + Intronic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950627971 3:14262227-14262249 GACAGGAGGCAGGAGGAAGAAGG - Intergenic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
951251342 3:20397313-20397335 GACAGAAAGCAGGAGTATGAGGG + Intergenic
951494373 3:23309906-23309928 TAGAGGAAGGTGGAGGAAGATGG + Intronic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951601406 3:24380180-24380202 GAGAGGGAGAAAGAGGATGATGG - Intronic
951964993 3:28372048-28372070 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
951996730 3:28738048-28738070 GAAAGGAAGGAAGAGGATGAGGG + Intergenic
952144029 3:30512095-30512117 GAGAGGGAGCAGGAGCAAGAAGG - Intergenic
952409540 3:33034703-33034725 CTGAGGAAGCAGTTGGTTGATGG + Intronic
952876836 3:37952409-37952431 AATAGCAAGCATGAGGATGAAGG - Intronic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953693105 3:45136378-45136400 CTAAGGAAGAAGGAGGAGGATGG + Intronic
953795530 3:45982929-45982951 CTGAGGAGGCAGGAGGGTGGAGG - Intronic
954111670 3:48437009-48437031 CAGTAGAAGGAAGAGGATGAGGG - Intronic
954452116 3:50577280-50577302 GAGGGGAAGCAGCTGGATGAGGG + Intronic
955143013 3:56288316-56288338 AAGGTAAAGCAGGAGGATGAGGG + Intronic
955628426 3:60946115-60946137 GTGAGGATACAGGAGGATGACGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955763603 3:62316760-62316782 CACAAAAAGCTGGAGGATGATGG - Intergenic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
956677023 3:71744954-71744976 CAGATGAAGTAAGAGAATGAAGG + Intronic
956867610 3:73384911-73384933 CAGAAGAAGCACGACGAAGACGG - Exonic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
958112494 3:89166625-89166647 CAGAGGAAGCAGGTGAATTTGGG - Intronic
958194609 3:90227954-90227976 AAGAGGAAGGGAGAGGATGATGG + Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959693196 3:109221378-109221400 CAAAGGAAGCAGGATCAGGAGGG - Intergenic
959951295 3:112183746-112183768 GGGAGGATGCAGGAGGCTGAAGG - Intronic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960216658 3:115047345-115047367 CAGAGGAATCAGGAAGAAAAAGG + Intronic
960575632 3:119226828-119226850 CAGAGGCAGCAGCTGGATTATGG - Exonic
960987508 3:123290430-123290452 CACAGGGAGAAGCAGGATGATGG - Intronic
961001252 3:123375526-123375548 CAGAGCAATCTGGAGAATGAGGG + Intronic
961077702 3:123997260-123997282 CAGAGGTAGCAGGAAGAGGAGGG - Intergenic
961306865 3:125964022-125964044 CAGAGGTAGCAGGAAGAGGAGGG + Intergenic
961523786 3:127483824-127483846 AAGAGGAGGGAGGAGGAAGAGGG + Intergenic
961614309 3:128166778-128166800 GAGAGCAAGCAGGAGGGAGAAGG - Intronic
961714691 3:128850206-128850228 CAGAGGAAGCAGGAGCACACAGG + Intergenic
961820063 3:129571393-129571415 CAGAGGCAGAGGGAGGAAGAGGG + Intronic
961920408 3:130419121-130419143 AACAGCAAGCAGGAGAATGAGGG + Intronic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962838864 3:139215410-139215432 CAGAGGAAGCTGGAGTTAGAGGG + Intronic
963021754 3:140878627-140878649 CGGACCAATCAGGAGGATGAGGG + Intergenic
963473688 3:145776523-145776545 CAGAGGAAGAGGGAGAAAGAGGG - Intergenic
963517462 3:146326421-146326443 CAGAGGAGGAATGAGGATGAAGG + Intergenic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964427609 3:156569699-156569721 CATAGGCAGCAGGATCATGAGGG + Intergenic
965360723 3:167735225-167735247 CAGAGGAAGGAAGGGGGTGAGGG + Intronic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
965756211 3:172029912-172029934 AAGAGGAAGCAAGAGAAGGAAGG - Intergenic
965855268 3:173080513-173080535 GAGAGGAAGGATGAGGATGACGG + Intronic
966040815 3:175485669-175485691 TAGAAAAAGCAGGAAGATGAAGG - Intronic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966695279 3:182783750-182783772 CAGAGGGGGCAAGAGGAGGAAGG + Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967192672 3:186998553-186998575 CAGAGGTAGAAGGAGGGCGAGGG + Intronic
967684027 3:192398874-192398896 CAGAGGAAGAAGGATTCTGAAGG - Intronic
967943034 3:194780827-194780849 CAGAGGACGGGGGAGGTTGAGGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968278899 3:197460445-197460467 TAGAGGGAGGGGGAGGATGAAGG + Intergenic
968565773 4:1311953-1311975 GAGAGGAAGGAGGATGGTGAGGG - Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968639412 4:1704622-1704644 CAGGGGAAGCACGAGGTTGCTGG - Intronic
968968950 4:3783629-3783651 CGGAGGAAGCTGGAGGCTGAGGG - Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969107884 4:4821615-4821637 CAGAAGAAGAAGGAAGGTGAGGG + Intergenic
969119927 4:4900666-4900688 CCCAGGAAGCAGGAGGAAGTGGG - Intergenic
969175129 4:5392937-5392959 CACAGGAAGCAGGAGACAGAAGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969586461 4:8097005-8097027 GGGAGGGAGCAGGAGGAAGAAGG + Intronic
969617766 4:8263299-8263321 CAGAGGTTGCAGGAAGGTGAGGG + Intergenic
969994874 4:11301798-11301820 AAGAGGAAACAGGAGCATCAGGG - Intergenic
969996980 4:11323415-11323437 CAGAAGAAGTAGGAAGATGAAGG + Intergenic
970277157 4:14413489-14413511 CAGAGGATGATGGAGAATGAAGG + Intergenic
970346878 4:15160799-15160821 CTGAGGATGGAGGAGAATGAGGG + Intergenic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
971041298 4:22755046-22755068 CAGAGGAAGAATGAGGTTGAAGG + Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971661698 4:29426112-29426134 GAGAGGAAGAGGGAGGAGGAAGG - Intergenic
971885856 4:32446695-32446717 TAGAGGAAGCTGTAGGATGTGGG + Intergenic
971969495 4:33603715-33603737 CACAGGTAGCTGGAGGAGGATGG + Intergenic
972789365 4:42356077-42356099 CAGAGGGAGGAGGAGAGTGAAGG + Intergenic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973218706 4:47700795-47700817 AGGAGGAAGCAGGGGGATGTAGG - Intronic
973243774 4:47987938-47987960 TAGAGGAAGCAAGGGGAAGAGGG + Intronic
973554057 4:52064416-52064438 GAAAGGAAGGAGGAGGGTGAGGG - Intronic
973604203 4:52570529-52570551 TAGAGGAAGCAGTAGGAATAGGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973711433 4:53633721-53633743 CAGAGGAGGAAGATGGATGAGGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975458580 4:74623496-74623518 CAGAGGAAATAGGGAGATGAAGG + Intergenic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
977205247 4:94158613-94158635 AAGACAAAGCAGGAGGAAGAAGG - Intergenic
977611231 4:99034184-99034206 GAGAGGAAGGAGGAGAAGGAGGG - Intronic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
978133342 4:105226637-105226659 GAGAGGAAGAGGGAGGAAGAGGG - Intronic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981341585 4:143627950-143627972 CAGATTAAGCAGGAGGAATAGGG - Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982378202 4:154718226-154718248 GAGAGGTTGCAGGAGGGTGAGGG - Intronic
982422182 4:155210427-155210449 GAGAGGAAGCATGAGATTGAAGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
985402541 4:189606730-189606752 GAGAGGGAGAAGGAGGAAGATGG - Intergenic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985876925 5:2606985-2607007 CAGATGGAGCAGGGGGCTGAAGG - Intergenic
986266634 5:6196706-6196728 TAGAGGCAGCAAGAGGATGGCGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986361668 5:6984268-6984290 CAGAGGAAGCAGGAGGCATCTGG + Intergenic
986707581 5:10464191-10464213 CAGAGGAAGGAGGAAAAAGAGGG - Intronic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987163824 5:15173306-15173328 AAGAGGAAGGAAGAGAATGAGGG + Intergenic
988153756 5:27422139-27422161 CAGAGGGAGCTGGAGGAAAATGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988449419 5:31325945-31325967 GAGACGAAGCTGGAGAATGATGG - Exonic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988991099 5:36671909-36671931 GAGAGGAAGCAGGAAGGTGCTGG - Intronic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
990138023 5:52670662-52670684 CAGAGGAAGTATGGGCATGAGGG + Intergenic
990358503 5:54995145-54995167 AAGATTAAGCAGGTGGATGAAGG - Intronic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
990866101 5:60381673-60381695 CCGAGGAAGCAAGTGGAGGATGG + Intronic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992222117 5:74583387-74583409 CATAGGATGCAGGAAGAGGAAGG - Intergenic
992676617 5:79112020-79112042 GGGAGGGAGTAGGAGGATGATGG - Intronic
992737867 5:79742021-79742043 AAGAGGGAGGAGGAGGAGGAAGG - Intronic
992948074 5:81829214-81829236 TAGAAAAAGCAGGTGGATGAAGG + Intergenic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
993479162 5:88401576-88401598 CAGAGAAAGCAAGAGGAAAATGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994666302 5:102709550-102709572 CAGATGAAGTAAGTGGATGATGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995608036 5:113879376-113879398 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
995710426 5:115029901-115029923 CAGAGGTAGCTGGAAGCTGAAGG - Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996490462 5:124088619-124088641 TGGAGGAAGCAAGATGATGAGGG + Intergenic
996521971 5:124437243-124437265 CACTGGAGGCAGGAGGCTGATGG + Intergenic
997596466 5:135110479-135110501 TAAAGAAAGCAGCAGGATGAGGG - Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997771767 5:136561639-136561661 AAGAGGAAGGAGGAGAAGGAGGG - Intergenic
997801239 5:136864762-136864784 CAGTGGAGGGAGGAGGCTGATGG + Intergenic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998524672 5:142831647-142831669 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
999784908 5:154882255-154882277 CAGTGGAAGGGGGAAGATGAGGG - Intergenic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000343396 5:160294753-160294775 CAGAGGGCGTGGGAGGATGAGGG - Intronic
1000371502 5:160540899-160540921 CAGAGGAAGAAAGAATATGAAGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000759901 5:165209638-165209660 CAGATGAAGCAGGAGATTCATGG + Intergenic
1001132903 5:169079536-169079558 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1001315096 5:170636345-170636367 CAGTGGAGGCAGGAGGCAGAAGG + Intronic
1001553388 5:172620275-172620297 CAGAGGAAGCAGAGGGATATTGG - Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1002131245 5:177083013-177083035 AAGAGGAAGCTGGAGCATGACGG + Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002449880 5:179312674-179312696 CAGAGGGAGATGGAGGATGTCGG + Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002833455 6:845239-845261 CAGAGTAAGAGGGAGGATGCAGG + Intergenic
1002936698 6:1680265-1680287 ACGAGGAAGCAGGTGGATGAAGG - Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1003785536 6:9482009-9482031 GAGAGGAAGCCCGAGGAAGATGG - Intergenic
1004691762 6:17998227-17998249 AAGAGGAAGCAGGAGCTTGTGGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005222429 6:23601905-23601927 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
1005476389 6:26212180-26212202 CAGAGGAACAAGAAGGATTAAGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005944492 6:30585481-30585503 CAGAGGAAGCAGGCAGACAACGG - Intronic
1006057508 6:31396254-31396276 CAGAGGAAGAAGGAGCACAAGGG - Intergenic
1006069932 6:31490911-31490933 CAGAGGAAGAAGGAGCACGAGGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006583149 6:35088147-35088169 CGGAGGAGTCAGGAGGCTGAGGG - Intronic
1007068660 6:39018625-39018647 CAGATGACTCAGGAGGAAGATGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007244503 6:40450881-40450903 CAGAGGAGGAAGGAAGATCAGGG + Intronic
1007257800 6:40540916-40540938 CAGAGGCTGCAGGAGGCTGCTGG + Intronic
1007682634 6:43645106-43645128 CAGAGACAGCAGGAGGCTGTCGG - Exonic
1008051721 6:46906904-46906926 AAAAGGAAGGAGGAGCATGAAGG + Intronic
1008198733 6:48559850-48559872 CAAAGAAAGCAGGAGGAAGTGGG - Intergenic
1008690309 6:53971451-53971473 AAGAGGAAGAAGGAAGGTGAAGG + Intronic
1008779781 6:55089650-55089672 AAGAGGATGGAGGAGGAAGAAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010149985 6:72719948-72719970 CATAGAAAGGATGAGGATGAAGG - Intronic
1010196878 6:73248426-73248448 GAGAGGAAGGAGGGGGAAGAAGG - Intronic
1010330844 6:74622751-74622773 CAGAGAAGGCAGGAAGATGTGGG + Intergenic
1010443020 6:75919971-75919993 CAGAGGACCCAGCAGGATCATGG - Intergenic
1010753101 6:79636467-79636489 CAGAAGAAGCAGGAGTAAGTTGG + Intronic
1011215925 6:85005568-85005590 AAGAGGAAGCAGGAGGATCAGGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011855007 6:91679016-91679038 AAGAGGAAGCAAGAGGTTTAGGG + Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012670085 6:102033373-102033395 GAGAGGAAGCAAGAGCATGCTGG - Intronic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013177362 6:107689307-107689329 GAGAGGGAGCAGGAGGCTGAGGG + Intergenic
1013213236 6:108005050-108005072 CAGAGGAAGCAGGCGCATCTGGG + Intergenic
1013479777 6:110543737-110543759 TGGAGGAAGCAGGAGCATGGAGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014258116 6:119184572-119184594 CTGAGGAGGCAGGAGTAGGAAGG + Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015718475 6:136216088-136216110 GATAGGCAGCAGGAGGAGGAAGG + Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1017133437 6:151127883-151127905 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017646355 6:156543087-156543109 CAGAGGGAGGAGGAGTGTGATGG - Intergenic
1017927758 6:158924800-158924822 GAGAGGGAGAAGGAGGAGGAAGG + Intergenic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1018574480 6:165245004-165245026 CAGAGCCAGCAGGAGGAATAAGG + Intergenic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019152604 6:170018934-170018956 GAGAGGAGGCAGGAGGGTGTGGG + Intergenic
1019228867 6:170540367-170540389 CAGAGGAGGAAGGGGGCTGAAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019604104 7:1899892-1899914 CAGAGGAAGATGGAGGACGCGGG + Intronic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020254165 7:6492773-6492795 TAGAGGAGGAAGGAGGAGGAGGG + Intergenic
1020340174 7:7101519-7101541 CAGAGGGAGCAGGAGGGAGTAGG - Intergenic
1021301635 7:18980697-18980719 AAGAGGAAGAAGGAAGAAGAAGG - Intronic
1021588542 7:22236555-22236577 CAGGGGAAGGAGGACCATGAAGG - Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022151828 7:27616153-27616175 AAGAGGAAGCAAGAGAAAGAAGG + Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022785069 7:33630685-33630707 CAGAGGAAGAGGGGTGATGAAGG - Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023363650 7:39441425-39441447 CAGAGAAAGCAAGAGGAGCAAGG + Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023693433 7:42818639-42818661 AAGAGGAAGAAGGAGAAGGAAGG + Intergenic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023955218 7:44880742-44880764 CAAAGGAAGCAGGAGGTTAACGG + Exonic
1024200756 7:47103687-47103709 CATGGGGAGCATGAGGATGAGGG - Intergenic
1024232637 7:47374332-47374354 CACAGGTGGCAGGAGGATAAAGG - Intronic
1024584056 7:50825725-50825747 GAGTGAAAGCAGGAGGCTGAAGG + Intergenic
1024600989 7:50981718-50981740 GAGAGGACGCAGGAGAATTAGGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026471079 7:70694493-70694515 GAGAGGGAGGAGGAGGAGGAGGG - Intronic
1026548081 7:71341931-71341953 CTGTGGATGCAGGAGGATGCAGG + Intronic
1027051836 7:75025596-75025618 CAGAGGAGGGAGGAGGACGGCGG - Intergenic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027823752 7:83084013-83084035 CAGAGGAAAGATGAAGATGAAGG + Intronic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1028182909 7:87747370-87747392 CGGAGGTAGCAGGGGGGTGAGGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028887716 7:95952780-95952802 CAGAGGAAGGACGAGGCAGAGGG - Intronic
1029361074 7:100089032-100089054 CGGAGGAAGCAGCGGGATGGAGG + Exonic
1029380123 7:100208546-100208568 CAGAGGAAGGAGGAGCATCATGG + Intronic
1029525231 7:101089784-101089806 CAGAGGAGGCAGGTGGGTGGAGG + Exonic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029906500 7:104098633-104098655 CACAGGAAGCAGGTGGAAGGCGG + Intergenic
1030078849 7:105760007-105760029 TAGAGCAGGCAGGAGAATGAGGG - Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030473911 7:110003582-110003604 GAAGGGAAGGAGGAGGATGAAGG + Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030570864 7:111221974-111221996 CACAGTCAGCAGGGGGATGATGG + Intronic
1031142225 7:117956031-117956053 TGGAGAAAGAAGGAGGATGAGGG + Intergenic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1031854634 7:126907312-126907334 AAGAGGAAGGAGGGGGAAGAAGG + Intronic
1031915697 7:127560853-127560875 CATAAGAAGCAGGAAGAAGAAGG + Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033779743 7:144654462-144654484 AAGAGGAAGTAGGAGGAACAAGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034868155 7:154658270-154658292 CAGGGGAAGAAGGAGGATATGGG + Intronic
1034926980 7:155130333-155130355 CTGAGGCAGCTGGAGCATGATGG - Intergenic
1034935333 7:155196107-155196129 AATAGGAAGCAGGAAGATGGTGG - Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035117456 7:156536600-156536622 GAGAGGGAGCAGGAGCAGGAGGG + Intergenic
1035304876 7:157925525-157925547 CAAAGGAAGCTGGAGGGAGAGGG - Intronic
1035473708 7:159128110-159128132 CAGAGGCAGCAGGAGCCTGAAGG - Intronic
1035595312 8:853233-853255 CAGAGGGAGAAGGTGGAGGAGGG + Intergenic
1036414849 8:8537510-8537532 CATAGGCAGAAGGAGGAGGATGG - Intergenic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1036752549 8:11452493-11452515 CAGAGGCAGAAAGAGCATGAAGG + Intronic
1037024333 8:14014401-14014423 ATGAGGAAGAAAGAGGATGAGGG + Intergenic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1037670800 8:21013601-21013623 CAGAGGAAGGAGGGGGGTGCAGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037858363 8:22387759-22387781 CAAAGGAAGCAGGAGGAACCTGG - Intronic
1038085911 8:24195928-24195950 CAGGGGTAGAAGGAGGATGTGGG + Intergenic
1038339641 8:26674541-26674563 CGGAGCAAGCAGGAGGCTGATGG + Intergenic
1038697523 8:29819415-29819437 CAGAGGGGGCAGCAGGCTGATGG - Intergenic
1039042986 8:33425592-33425614 CAGAGGAAGGGGGAGGGTGGAGG + Intronic
1039156301 8:34562346-34562368 AAGAGGAAGGAAGAGGAAGAAGG + Intergenic
1039634399 8:39147623-39147645 CAGAGGAAGAAGGTGGATGCTGG - Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041467068 8:58167516-58167538 GAGAGGCAGCAGGAAGTTGAGGG - Intronic
1042144543 8:65714391-65714413 CACAGGAACCAGGAAGATGGAGG + Intronic
1042559472 8:70062259-70062281 CAGAGCAAGCAACAGAATGAGGG - Intronic
1042963990 8:74331224-74331246 CACAGGAAGCAGGAGTAGGCGGG - Intronic
1043280749 8:78462857-78462879 AAGAGGAAGCATGAGTAGGATGG - Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045242110 8:100411635-100411657 CAGAGGATGCAGTAGGATCAGGG + Intergenic
1045490203 8:102662460-102662482 CTGAGGAAGAAGCAGGCTGAAGG + Intergenic
1045784789 8:105908434-105908456 CAGAGGCTGAAGGAGGCTGAAGG + Intergenic
1046051671 8:109030171-109030193 CAGAGGAAATAGGAGCATAATGG - Intergenic
1047073647 8:121375986-121376008 AAGAAGAAGGAGGAGTATGAGGG - Intergenic
1047192983 8:122695464-122695486 GCCAGGGAGCAGGAGGATGAGGG + Intergenic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047719257 8:127623883-127623905 CAGAGGAAGCCACAGGATGACGG - Intergenic
1047741536 8:127810613-127810635 CAGAGGCAGCAGGTGAATGTGGG + Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048080546 8:131121884-131121906 CAGAGGCAGAAGGGAGATGAAGG + Intergenic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048311727 8:133327908-133327930 CAGAGGAAGCAAGATTGTGATGG + Intergenic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049145721 8:141000498-141000520 GAGAGGCAGGAGGAGGAAGAGGG - Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049346332 8:142141076-142141098 AAGAGGAAGCAGGAGGGAGAAGG - Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049563936 8:143327687-143327709 CAGAGGGAGAATGAGGATGCCGG + Intronic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1049672576 8:143876512-143876534 AGGAGGAAGCAGGTGGACGAAGG - Intronic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1050775088 9:9249605-9249627 AAGAGAAAGAAGGAGGAAGAGGG - Intronic
1050877490 9:10656903-10656925 CAGAGGAAGGGTGGGGATGAGGG + Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051432007 9:16988797-16988819 CATAGGCAGCATGAGGAGGATGG + Intergenic
1052270039 9:26618203-26618225 CAGAGGAAGAATGTAGATGAAGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052973574 9:34396387-34396409 CAGATGAGGAAGGAGGATGTAGG - Intronic
1053609592 9:39698794-39698816 CAAAGGAAGCAGGCGAATGTGGG - Intergenic
1053867550 9:42455699-42455721 CAAAGGAAGCAGGCGAATGTGGG - Intergenic
1054088663 9:60772363-60772385 CAAAGGAAGCAGGCGAATGTGGG + Intergenic
1054243932 9:62643603-62643625 CAAAGGAAGCAGGCGAATGTGGG + Intergenic
1054558056 9:66678151-66678173 CAAAGGAAGCAGGCGAATGTGGG + Intergenic
1054728422 9:68676289-68676311 GAGAGGAAGCAGGTGGATGGAGG - Intergenic
1055078010 9:72237106-72237128 CAGGTGGAGCAGGAGCATGAGGG - Intronic
1055080274 9:72261824-72261846 AGGAGGAAGAAGGAGGAGGAGGG - Intergenic
1055581428 9:77711025-77711047 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1055688688 9:78806900-78806922 AAGATGAAGCAGGAGTAAGAAGG + Intergenic
1056071570 9:82992620-82992642 GAGAGGGAGGAGGAAGATGATGG + Intronic
1056134514 9:83618837-83618859 CAGAGATAGAAGGAGGATGTGGG - Intergenic
1056273473 9:84969941-84969963 CATTGGAAGCAGGGAGATGAGGG + Intronic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056850511 9:90080012-90080034 CAGAGGAAGGAGGAGAATAGGGG - Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057443605 9:95098849-95098871 AGGAGGAAGCAGGAGGACAAGGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057696753 9:97328625-97328647 CAGAGGGAGCACGATGAGGAAGG - Intronic
1057706370 9:97397968-97397990 CAGAGGCAGCGAGAGGAGGAGGG - Intergenic
1058138532 9:101334286-101334308 CAGAAGCAGCGGGAGGATGCTGG - Intergenic
1058139283 9:101340904-101340926 GAGAGGAAGCAAGAGAAAGAGGG + Intergenic
1058328536 9:103728419-103728441 GAGAGGGAACAGGAGGGTGATGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072479 9:111153014-111153036 AGGAGGAAGGAGGAGGAAGAAGG + Intergenic
1059163036 9:112053090-112053112 CAGAGGAAGCTGCACGGTGAGGG + Intronic
1059328880 9:113522716-113522738 TATAGGAAGCTGGAGGGTGATGG + Intronic
1059682866 9:116603598-116603620 CAGTTGAGGCAAGAGGATGAAGG + Intronic
1059774342 9:117460692-117460714 CAGAGGAAGTGTGAGGAGGAGGG + Intergenic
1059826712 9:118038025-118038047 AAGAGGATGCAGGAGGATGGGGG + Intergenic
1059892911 9:118824805-118824827 CAGAGGATGTGGGAGAATGAAGG + Intergenic
1060202708 9:121661054-121661076 GTGAAGAAGCGGGAGGATGAGGG + Intronic
1060213189 9:121723025-121723047 CCAAGGAAGCAGGAGCATGCTGG - Intronic
1060378613 9:123142585-123142607 AAGAGGAAACATCAGGATGAAGG - Intronic
1060500606 9:124151037-124151059 GAGAAGATGCAGGAGGATGCTGG - Intergenic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061034206 9:128104450-128104472 CAAAGGAAGCAGGTGGTTCAGGG + Intronic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061338476 9:129959818-129959840 CTGAGGAAGATGGAGGGTGACGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061924897 9:133801173-133801195 AAGAGGATGCAGGAGGTTGGGGG + Intronic
1062160970 9:135079643-135079665 CAGAGGCTGCAGCAGGAAGAAGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1203733780 Un_GL000216v2:116245-116267 CAGGTGAAGCAGGAGGCTCAGGG - Intergenic
1185556667 X:1026921-1026943 GAGAGGGAGGAGGAGGAGGAGGG - Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185969119 X:4642136-4642158 AAGATGAGGCAGGAGGATGGAGG + Intergenic
1186045571 X:5532888-5532910 CAGAGGAAGAAGGAGGGAGGGGG + Intergenic
1186148727 X:6651676-6651698 CAGTGGAAGCAGGTGGGTAAAGG - Intergenic
1186402591 X:9273577-9273599 AAAAGGAAGAAGGAGGAAGAAGG + Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1186701583 X:12095897-12095919 CACAGGAAGCAGGATGGAGAGGG - Intergenic
1186721378 X:12308100-12308122 CAAAGGGAGCAGGAGCATGCTGG - Intronic
1186804364 X:13125250-13125272 AGGAGGATGCAGGAGGGTGAAGG + Intergenic
1186879448 X:13850295-13850317 GAGAGGAAGCAAGAGAAAGAGGG - Intronic
1187009994 X:15268975-15268997 CAAAGGGAGCAGCAGGGTGAGGG - Intronic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1187603666 X:20860699-20860721 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1189007181 X:37008876-37008898 GAGAGGAAGCTGGAGGACGCAGG + Exonic
1189109063 X:38268234-38268256 AAGAGGAAGCAAGAGGGAGAGGG - Intronic
1189266951 X:39724493-39724515 CAGAGGAAGCAGGGGCGTGGGGG - Intergenic
1189692835 X:43635016-43635038 GTGAGGTAGCAGGAAGATGAGGG - Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190485879 X:50924510-50924532 CAGATGAACCTGGAGGATGGAGG - Intergenic
1190795523 X:53737642-53737664 GAGAGGATGCAGGAGGCAGATGG - Intergenic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191696279 X:63994071-63994093 TTGAGGAAGCAGGAGGAAAAGGG + Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1192080887 X:68046812-68046834 CTGAGGAAGCAGGAAGTTCAGGG + Exonic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1192996900 X:76521321-76521343 GAGATGAAGCGGGAGGAAGATGG - Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1193245225 X:79220615-79220637 CAGAGGTGGCAGGGGAATGAAGG + Intergenic
1194033422 X:88842850-88842872 TAGAGGTTGCAGAAGGATGAAGG + Intergenic
1194904006 X:99550960-99550982 CAGAGTGAGAAGGAGCATGACGG - Intergenic
1195137117 X:101919756-101919778 CAGGGGAGGCAAGAGTATGAAGG + Intronic
1195244243 X:102981184-102981206 TAGAAGAAGGAGGAGGATCAGGG - Intergenic
1195350157 X:103987935-103987957 CAGCGGATGCAGGAGGAAAAAGG - Intergenic
1195351762 X:104003155-104003177 CAGCGGATGCAGGAGGAAAAAGG + Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1195702612 X:107716432-107716454 CAGAGGCAGCCGGAGGCAGAGGG - Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196193682 X:112818936-112818958 CTTAGGAAGGAGCAGGATGAGGG - Intronic
1197091101 X:122538751-122538773 CAGAGGAAGCAGGCGTATCTGGG - Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1197730257 X:129803790-129803812 CATAGGAAGCTTGAGGAAGAAGG + Exonic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197761099 X:130028910-130028932 CAGAGGAGGCAGGAGGGGGGTGG + Intronic
1199616683 X:149661342-149661364 CATACGAAGCAGGGGGATGGGGG + Intergenic
1199625958 X:149741906-149741928 CATACGAAGCAGGGGGATGGGGG - Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1199941052 X:152628219-152628241 GACAGGAAGGAGGAGGAGGAAGG + Intergenic
1200531695 Y:4347687-4347709 CAGATGCAGCAGCAGGCTGAAGG - Intergenic
1201392212 Y:13510942-13510964 CAGATGGAGCAGGAGGTTGTGGG + Intergenic
1201422824 Y:13818956-13818978 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201683364 Y:16673477-16673499 CAGAGGAAGAAAGAGAAAGAAGG + Intergenic
1202627233 Y:56872176-56872198 CAGGTGAAGCAGGAGGCTCAGGG + Intergenic