ID: 1016594332

View in Genome Browser
Species Human (GRCh38)
Location 6:145782420-145782442
Sequence AAGTAATTTTAAAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016594331_1016594332 0 Left 1016594331 6:145782397-145782419 CCAATCAGATGAGAAAAAAGTAA No data
Right 1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG No data
1016594330_1016594332 1 Left 1016594330 6:145782396-145782418 CCCAATCAGATGAGAAAAAAGTA No data
Right 1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016594332 Original CRISPR AAGTAATTTTAAAAGAGTGA AGG Intergenic
No off target data available for this crispr