ID: 1016598274

View in Genome Browser
Species Human (GRCh38)
Location 6:145826136-145826158
Sequence TGGAAGACAAAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016598274_1016598281 0 Left 1016598274 6:145826136-145826158 CCCTGCTCCCTCTTTGTCTTCCA No data
Right 1016598281 6:145826159-145826181 CCATTCTTGGAAGCTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016598274 Original CRISPR TGGAAGACAAAGAGGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr