ID: 1016601530

View in Genome Browser
Species Human (GRCh38)
Location 6:145866906-145866928
Sequence AGGTAGACAGAGAGGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 761}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016601524_1016601530 -2 Left 1016601524 6:145866885-145866907 CCTGTGCTGATTGATGGGGGAAG 0: 1
1: 0
2: 2
3: 9
4: 150
Right 1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG 0: 1
1: 0
2: 4
3: 66
4: 761
1016601519_1016601530 4 Left 1016601519 6:145866879-145866901 CCTTTGCCTGTGCTGATTGATGG 0: 1
1: 0
2: 1
3: 16
4: 135
Right 1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG 0: 1
1: 0
2: 4
3: 66
4: 761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016601530 Original CRISPR AGGTAGACAGAGAGGGGACA GGG Intronic
900161251 1:1225029-1225051 AGGGACACAGACTGGGGACACGG + Intronic
900468192 1:2835919-2835941 AGGCAGAGAGAGAGGGGGCGAGG - Intergenic
900805337 1:4763824-4763846 AGGGAGACAAAGAGGAGAGAGGG - Intronic
901199731 1:7459857-7459879 AGGCATACAGAGAGGAGAAATGG + Intronic
903103981 1:21058461-21058483 AGGCAGCCAGAGTGTGGACATGG + Intronic
903316879 1:22515034-22515056 GGGTACACAGTGAGAGGACAGGG + Intronic
903772150 1:25770724-25770746 GGGCAGACAGAGAGGGGAGAAGG - Intronic
904827354 1:33282076-33282098 AGCTAGACTGAGAGAGGACAAGG - Intronic
905220140 1:36440354-36440376 AGCTACAGAGAGAGGGGAGAGGG + Intronic
905514293 1:38550537-38550559 CAGTAGACAGAGAGCGGAGATGG + Intergenic
905535822 1:38721033-38721055 AGGAAGGGAGAGAGGGGATAGGG - Intergenic
905915913 1:41684167-41684189 AGGCAGACAGTGAGGAGACCTGG - Intronic
906063536 1:42963487-42963509 AGGGAGACAGAGAGGGGTCAGGG - Intergenic
906078953 1:43071140-43071162 AGAGGGACAGAGAGAGGACAGGG + Intergenic
906237158 1:44218985-44219007 GGGTAGACACGGAGGTGACAGGG - Intronic
906991905 1:50747864-50747886 AGGAAGAGAGAGAGGGGAGGTGG - Intronic
907303512 1:53502126-53502148 AGGAAGACAGAGAGGACAGAGGG + Intergenic
907898316 1:58714031-58714053 AGGAAGACAGACAGGCAACAGGG + Intergenic
907961990 1:59292672-59292694 TAGTAGACAGAGAGGAGACACGG - Intergenic
908173524 1:61531174-61531196 AGGTGAACAGAGATGGGAAAAGG + Intergenic
909162299 1:72168375-72168397 AGGAAGAAAGAAAGAGGACATGG - Intronic
909366892 1:74835180-74835202 AGGTAGACAGGGAGAGGTCTTGG - Intergenic
910205314 1:84743572-84743594 AGCTATACAGTGAGAGGACAGGG + Intergenic
910450396 1:87337728-87337750 AGGTAGCCAGAGAATGGGCATGG - Intronic
910769593 1:90817498-90817520 AGGGAGACACAGAGGGGAGTAGG - Intergenic
913246153 1:116871660-116871682 AGGCAGAAAGGGAGGGGAGATGG + Intergenic
913428068 1:118756877-118756899 AGGTAGAAATAGAGGAAACAAGG + Intergenic
913571505 1:120124907-120124929 AGTAAGACAAAGAAGGGACAAGG - Intergenic
914197935 1:145459870-145459892 AGGGAGACGAAGAGGGGACGAGG - Intergenic
914220764 1:145679978-145680000 AAGTAGACAGAGCTGGGATAAGG - Intronic
914292426 1:146286528-146286550 AGTAAGACAGAGAAGGGACAAGG - Intergenic
914473339 1:148002851-148002873 AAGTAGACAGAGCTGGGATAAGG - Intergenic
914477037 1:148033002-148033024 AGGGAGACGAAGAGGGGACGAGG - Intergenic
914553470 1:148737311-148737333 AGTAAGACAGAGAAGGGACAAGG - Intergenic
914720748 1:150286842-150286864 GGGTAGACTGGGAGGGGATAGGG - Exonic
915252850 1:154602811-154602833 AGGAACACAGAGAGGGGAGCAGG + Intronic
915363688 1:155301471-155301493 AGGGAGACAGAGAAGAGAAAAGG + Intergenic
915939043 1:160106818-160106840 AGCAAGACAGAGAGGAGACAGGG - Intergenic
916052656 1:161047326-161047348 AGGTAGAGACAGGGAGGACAGGG - Exonic
916190698 1:162174998-162175020 AGGAAGACAGAGAGGTAAGATGG + Intronic
916214530 1:162384100-162384122 AGGAGGAGAGAGAAGGGACAGGG - Intronic
916846076 1:168651624-168651646 GGGGAGAAAGAGAGGGGACTAGG - Intergenic
917309402 1:173662878-173662900 AGGTAGACAGGGATTGGAAATGG + Intronic
917587582 1:176443520-176443542 AGGGAGACAGAGGGAGCACATGG + Intergenic
917691882 1:177478160-177478182 AGGAAGAGAGAGAGGGAAGAAGG - Intergenic
918359629 1:183742731-183742753 AGAAAGAGAGAGAGGGGACGGGG + Intronic
918757938 1:188360415-188360437 AGATAGAGAGAGGGGGGAAAGGG - Intergenic
919917469 1:202147624-202147646 AGGTAGACAGTGAGGAGTCCTGG + Exonic
919917905 1:202150429-202150451 AGATAGCCAGGGAGGGGACAGGG + Intronic
919986466 1:202679207-202679229 AGGGAGACAGAGAAGGGAGTCGG - Intronic
920039612 1:203086850-203086872 AGTGAGACAGGGAGGAGACAGGG - Intergenic
920073130 1:203317545-203317567 AGGTGGAAAGGAAGGGGACAGGG - Intergenic
920707948 1:208268455-208268477 AGGGAGAGAGAGAGGGAAAATGG + Intergenic
921088087 1:211815333-211815355 AGGTAGAGAGAGAGGTGACAGGG - Intronic
921137518 1:212274828-212274850 AGTGAGACAGAGAGGGGAGGAGG + Intergenic
921317307 1:213904960-213904982 AGGTAGGAAGAGAGGGAAAAAGG + Intergenic
921834102 1:219760201-219760223 AAGTAGACAGAGGGAGGACCTGG + Intronic
922515399 1:226204267-226204289 AGGCAGACAGGCAGGGGATAAGG + Intergenic
922741414 1:228016217-228016239 ATGAAGACAGACAGGGGCCATGG + Intronic
924517660 1:244779999-244780021 AGCTGGACAGATAGAGGACATGG - Intergenic
924925469 1:248676275-248676297 AGGGAGAGGGAGAGGGGAGAGGG - Intergenic
1063082593 10:2782665-2782687 AGGTAGGAGGAGAGGGGAGACGG - Intergenic
1063540364 10:6927733-6927755 AGGGAGTCAGGGAGGGCACATGG - Intergenic
1063665557 10:8058442-8058464 GGGTAGACGGAGAGGGGCCCCGG - Exonic
1063876500 10:10484251-10484273 AGGGAGAGAGAGAGGGGGGAGGG - Intergenic
1063876509 10:10484274-10484296 AGGGAGAGAGAGAGGGGGGAGGG - Intergenic
1064117462 10:12591137-12591159 TGTTAGACACAGAGGGGTCAGGG + Intronic
1064154507 10:12892705-12892727 AGGTAGACAAAGAGAGGTCAAGG + Intergenic
1064473314 10:15659766-15659788 ATGTAGACAGAGAGGGCAGAAGG + Intronic
1064817535 10:19283577-19283599 AGGAAGACAGAAAGGGGAAAGGG - Intronic
1064934075 10:20660646-20660668 AGAGAGAAAGAGAGAGGACAGGG + Intergenic
1065061083 10:21901232-21901254 AGGTACAAAGAAAGGGGTCAAGG + Intronic
1065434091 10:25689433-25689455 GGTGAGTCAGAGAGGGGACAGGG + Intergenic
1065768017 10:29050077-29050099 AGGGAGAGAGAGAGAGGTCAAGG + Intergenic
1067047596 10:42993258-42993280 ATGTACACAGAGTGGGGAGATGG - Intergenic
1067339593 10:45391045-45391067 AGGGAGAGGGAGAGGGGAGAGGG - Intronic
1067459218 10:46445069-46445091 AGGTAGACGGAGACTGGAGAAGG + Intergenic
1067627978 10:47939561-47939583 AGGTAGACGGAGACTGGAGAAGG - Intergenic
1067742872 10:48909624-48909646 AGGAAGAGAGAGAGAGGAGAGGG + Exonic
1067939082 10:50637396-50637418 AGGCAGAAAGAGAGGGGAGGAGG + Intergenic
1068120569 10:52779278-52779300 AGGGAGACAGAGATGGGAGGAGG - Intergenic
1069794385 10:71042912-71042934 AGCCAGACAAGGAGGGGACAGGG - Intergenic
1069929744 10:71874426-71874448 AGAAAGAAAGAAAGGGGACACGG - Intergenic
1070395324 10:76007251-76007273 GGGTGGGCAGAGAGGGGCCAAGG - Intronic
1070626276 10:78053590-78053612 AGGGAGCCTGAGAGGGGAGAAGG + Intronic
1070729146 10:78813413-78813435 AGGTAGGTGGGGAGGGGACAGGG - Intergenic
1071379766 10:85046647-85046669 AGGGAGACAGATATGGGAGAAGG + Intergenic
1071988593 10:91076953-91076975 AGGGAGACAGAGGGGAGAAAGGG - Intergenic
1072291381 10:93968831-93968853 ATGTGGACAGAGAGAGGCCAAGG + Intergenic
1072770642 10:98134720-98134742 AGGTACAGAGGGAGGGGATACGG - Intronic
1073112793 10:101072493-101072515 AGGCAGAGAGAGATGGGAAAAGG + Intergenic
1073122755 10:101132298-101132320 CGGGAGACAGAGAGGGGTCCAGG - Intronic
1073154432 10:101335216-101335238 AGGGAGACAGAAAGGGCAGAGGG - Intergenic
1073446218 10:103582189-103582211 TGGGAGACAGAGAGGGGAAGGGG - Intronic
1073478862 10:103772841-103772863 AGCTAGATAGAAAGGGCACAAGG - Intronic
1073945378 10:108744147-108744169 AGATAAACAGAAAGGAGACATGG + Intergenic
1074339505 10:112613480-112613502 AGCTCTACAGAGAGGGGAGAAGG - Intronic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1075330944 10:121573641-121573663 AGGAAGAAAGAGAGGGGAAGGGG + Intronic
1075420277 10:122295305-122295327 AGGGGGAGAAAGAGGGGACAGGG + Intronic
1075720991 10:124587388-124587410 AGGTAGAAGTGGAGGGGACATGG - Intronic
1076092024 10:127694626-127694648 AGGTAAACCTAGAGGTGACACGG + Intergenic
1076404030 10:130200767-130200789 AGGTACACAGAGAAAGGACACGG + Intergenic
1076587778 10:131561021-131561043 AGATAGACAGAGGGAGGCCAAGG - Intergenic
1076739411 10:132475691-132475713 AGGTCGATGGAGAGGGGAAAGGG - Intergenic
1076991953 11:280051-280073 CGGGAGACAGCGCGGGGACAAGG - Intronic
1077163248 11:1123096-1123118 AGGGAGAGAGAGAGGGAAGAGGG - Intergenic
1077552264 11:3205994-3206016 GGGGAGAAAGGGAGGGGACAAGG - Intergenic
1077909836 11:6564186-6564208 AGGGAGGCAGTGAGGGCACAGGG - Intronic
1078016759 11:7621574-7621596 AGGAAGAAACAAAGGGGACAGGG - Intronic
1078204216 11:9213833-9213855 AGTGAGCCAGGGAGGGGACAAGG + Intronic
1078443824 11:11389316-11389338 AGGTGGACAAATAGAGGACACGG - Intronic
1078577152 11:12512255-12512277 AGAAGGACAGAGTGGGGACAGGG - Intronic
1078628885 11:12983729-12983751 AGGAAGGCAGGGAGTGGACATGG - Intergenic
1079166857 11:18052136-18052158 AGGTAAAGAGGGAGGGGTCAGGG - Intergenic
1079189390 11:18265160-18265182 AGGAAGACAGAGAGGGAGTAAGG + Intergenic
1079306399 11:19327286-19327308 ATGTAGTCAGTGAGGGGAGAGGG - Intergenic
1079464230 11:20713584-20713606 GGGCAGACAGGGAGGGGGCAAGG - Intronic
1079699882 11:23531836-23531858 AGGAAGACAGAGAGGAAAAATGG - Intergenic
1079757776 11:24286965-24286987 AGGGAGAGAGGGAGAGGACAAGG + Intergenic
1080382537 11:31788454-31788476 AGGGAGACAGAAAAGGGAGAGGG + Exonic
1080759160 11:35231065-35231087 AGGGAGAGAGGGAGGGGAGAGGG - Intronic
1080825938 11:35849432-35849454 AGGAAGGCAGAGAGGGTACATGG - Intergenic
1082047720 11:47743694-47743716 ACGTAGACAGAGAGAAGAAATGG + Intronic
1083220886 11:61251592-61251614 AGGAAGACAGAGAGGCTTCAGGG + Intergenic
1083628270 11:64082918-64082940 AGGAAGGCAGAGAGAGGTCAGGG - Intronic
1083803898 11:65062413-65062435 AGGAGGACAGGGAGGGGACCGGG - Intergenic
1083902680 11:65651217-65651239 AGGTGGGTAGAGAGAGGACAAGG - Intergenic
1084173825 11:67413198-67413220 GGGTCGGCAGAGAGGGGAAATGG - Intronic
1084453537 11:69254201-69254223 AGGAAGACAGAAACGGGAAATGG - Intergenic
1084563586 11:69917540-69917562 AGGGAGAGAGAGAGGAGAGAGGG - Intergenic
1084563630 11:69917818-69917840 AGGGAGAGAGAGAGGAGAGAGGG - Intergenic
1084563633 11:69917837-69917859 AGGGAGAGAGAGAGGAGAGAGGG - Intergenic
1085139882 11:74130134-74130156 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1085205976 11:74732056-74732078 GGGCAGACGGAGTGGGGACAGGG - Intergenic
1085206540 11:74736728-74736750 AGGAAAACTGAGTGGGGACATGG + Intergenic
1085229909 11:74957677-74957699 AAGTAGACATAGAGGGGCAAGGG - Intronic
1085778781 11:79390029-79390051 AGGAAGAGAGACTGGGGACAGGG + Intronic
1087508652 11:99061329-99061351 AGAGGGACAGAGAGGGGACTGGG + Intronic
1088949332 11:114550966-114550988 AGGTAGAGAGAGAGAAGATAGGG + Intronic
1089111527 11:116061635-116061657 AGGGAAAGAGGGAGGGGACAAGG + Intergenic
1089146043 11:116330373-116330395 ACATAGACAGAGAGAGGCCAGGG + Intergenic
1089342451 11:117767635-117767657 AGGCAGTCAGAGAGTGGAAAAGG - Intronic
1089358392 11:117870534-117870556 AGGTAGGCAGAGAGAGCAAAGGG - Intronic
1089406034 11:118198384-118198406 ATGAAGAGAGAGAGGGGAGATGG + Intronic
1089458583 11:118639842-118639864 CGGCCTACAGAGAGGGGACATGG - Intronic
1090320284 11:125837263-125837285 AGGCAGACAGAGAGGTGATTTGG - Intronic
1090356856 11:126146363-126146385 AGGTACACAGAGAGGAGAGTGGG - Intergenic
1090991417 11:131820219-131820241 AGGGAGACAGACAGGGAAGATGG - Intronic
1091197889 11:133747386-133747408 AGGGAGACAGAGATGGAATAAGG - Intergenic
1091322279 11:134660180-134660202 AGGGAGACAGAGAGAGTAGAGGG - Intergenic
1091550820 12:1533774-1533796 AGGTAAACAGAGCCGGGCCAGGG - Intronic
1092037784 12:5353876-5353898 AAGAAGGAAGAGAGGGGACAGGG + Intergenic
1092714345 12:11373063-11373085 AGCTAGACACAGAGGGCTCATGG + Intronic
1094069279 12:26395158-26395180 AGGAGGACAGAGAGGAGACAAGG + Intronic
1095540646 12:43305272-43305294 AGGAAGACAGAGAGAGAAGAAGG + Intergenic
1096267474 12:50135191-50135213 AGGAAGAGAGAGAGAGGAGAGGG + Intronic
1096467318 12:51853971-51853993 AGGGAGACAGAGGGGTGCCAAGG + Intergenic
1096471855 12:51883086-51883108 AGGTAGTCAGAGAGACTACAAGG + Intergenic
1096676149 12:53227251-53227273 AGGAAGGCAGGCAGGGGACAGGG - Intronic
1096994778 12:55831662-55831684 AGGTTAATAGAGAGGGGAGAGGG - Intergenic
1097191103 12:57220083-57220105 AGGGCAACAGAGAGGGGGCAGGG + Intronic
1097220948 12:57450715-57450737 ACCTAGACAGAGAGGGAACAGGG - Exonic
1098427391 12:70380217-70380239 AGGTAGAGAGACAGGGGAACAGG + Intronic
1098491848 12:71091610-71091632 AGGTAGACAGAAAGAGACCAGGG - Intronic
1098584360 12:72138507-72138529 AGGCAGAAAGAGAGGAAACAAGG + Intronic
1099149893 12:79097193-79097215 AGGTAGAGTGAAAAGGGACATGG + Intronic
1099216371 12:79858820-79858842 ATGGAGTCAGAGAGGTGACAAGG + Intronic
1100473764 12:94916992-94917014 AGGAAGAGAGAGATGGGACTGGG + Intronic
1100822083 12:98441093-98441115 GGGAAGACAGAGAGGGGTGAGGG + Intergenic
1100848441 12:98684381-98684403 AGGGAGAGAGAGAGAGGAGAGGG - Intronic
1101728931 12:107410683-107410705 AAGGAGAAAGAGAAGGGACAAGG + Intronic
1101757928 12:107635775-107635797 AAGGAGACAGTGAGGGGCCAGGG + Intronic
1102208706 12:111108665-111108687 GTGGAGACAGAGAGGGGAGATGG - Intronic
1102528420 12:113528634-113528656 AGGGAAACAGGGAGGGGGCAGGG - Intergenic
1102609354 12:114097781-114097803 AGGTAGAGGGAGTGGGGACTGGG - Intergenic
1102679790 12:114683681-114683703 AGGAAGACAGATAGGGGGCGGGG - Intronic
1102749155 12:115277198-115277220 AGGGAGGCGGAGAGGGGAAAGGG + Intergenic
1102983720 12:117262441-117262463 AGAGAGACAGAGAGAGGAGAGGG + Intronic
1103295850 12:119886360-119886382 AAGTATACAGAGTGGGGACCCGG - Intergenic
1103593492 12:122008875-122008897 AGGCAGCCAGTGAGGGGACCAGG - Intergenic
1103829567 12:123768079-123768101 AGAAAGATACAGAGGGGACAAGG - Intronic
1103846894 12:123908101-123908123 AGAGAGACAGGGAGGAGACAGGG - Intronic
1103846905 12:123908158-123908180 AGAGAGACAGGGAGGAGACAGGG - Intronic
1103846916 12:123908207-123908229 AGGAAGACAGGGAGGAGACAGGG - Intronic
1104301448 12:127568704-127568726 AGGGAGAGAGAGAGAGGAGAGGG + Intergenic
1104404800 12:128508477-128508499 AGGGAGGCGGAGTGGGGACATGG + Intronic
1104947978 12:132425524-132425546 AGGGAGAGAGAGAAGGGAGATGG + Intergenic
1105527264 13:21187423-21187445 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1105575799 13:21650537-21650559 AGGGAGAGAGAGAGGGGAAAAGG - Intergenic
1105655727 13:22436007-22436029 AGAGAGACAGAGGGGGGAAAGGG + Intergenic
1107010933 13:35670274-35670296 AGGGAGAGGGAGAGGAGACAAGG + Intronic
1108715488 13:53074247-53074269 TCGCAGATAGAGAGGGGACAGGG + Intergenic
1108830387 13:54470704-54470726 AGGAAGAAAGAGAGGAGAGAGGG + Intergenic
1109151360 13:58852366-58852388 AGGTAGACAGAAAAGGTAGAAGG + Intergenic
1109235432 13:59812411-59812433 AGGAAGGCGGAGAGGGGAGAAGG + Intronic
1109526615 13:63583673-63583695 GGATAGACAGAAAGGGGAAAGGG + Intergenic
1110764026 13:79262560-79262582 AGAGAGACAGAGAGGTGTCAAGG + Intergenic
1110982378 13:81917217-81917239 GGGTAGAAAGGGAGGGGGCATGG + Intergenic
1112159318 13:96851594-96851616 AGGTATAGAGAGAGAGCACATGG - Intergenic
1112486605 13:99825886-99825908 TGGTGGGCAGAGAGGGGACTGGG - Intronic
1112958810 13:105095846-105095868 AGGTAGAAAGAGAAGGGTGAGGG + Intergenic
1113048989 13:106187589-106187611 AAGTAGACAGAGGGGAGAAACGG + Intergenic
1113319045 13:109214132-109214154 AAGTAGTCAGAGAGAGGACTGGG - Intergenic
1113352619 13:109544344-109544366 ATGTAGACAGAGGGAGGACATGG + Intergenic
1113672952 13:112187494-112187516 AGGGAGACAGAGAGAGGGGAGGG + Intergenic
1113781533 13:112980353-112980375 AGGTCGCCAGACAGGGGAAAGGG - Intronic
1114534858 14:23416340-23416362 AGGCAGACAGTCAGGGCACAGGG + Intronic
1114655722 14:24314570-24314592 TGGTAGCCAGAGAAGGGAAATGG - Exonic
1115368768 14:32588424-32588446 AGGCAGACACAAATGGGACAAGG - Intronic
1116002029 14:39254106-39254128 AGGTAGAGAGGGTGGGGAGAAGG + Intronic
1116164591 14:41318408-41318430 AGGTAGACACATAGTGAACATGG - Intergenic
1116192223 14:41675605-41675627 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1117010790 14:51468285-51468307 GGGGAGACAGAGATGGGAGAGGG + Intergenic
1117217282 14:53564605-53564627 AGGTAGAAAGAGATGCCACATGG - Intergenic
1118554815 14:67006283-67006305 AGGCAGACAGAAATAGGACAAGG - Intronic
1118916628 14:70112871-70112893 AGGAACACAGACAGGGGAGAAGG - Intronic
1119242727 14:73074970-73074992 AGGCAGGGAGTGAGGGGACACGG - Intronic
1119467039 14:74866389-74866411 ATGTAGACAGAGAAGGGAGGAGG + Intronic
1119924063 14:78474732-78474754 AGAAAGGCAGAGAGGGGATAGGG + Intronic
1120332899 14:83116193-83116215 AGAGAGACAGAGAGGTGATAGGG + Intergenic
1120874981 14:89367529-89367551 AGGTTGCCAGGGAGAGGACAGGG + Intronic
1121487895 14:94332386-94332408 AGGCAGGCAGAGTGGGGACTTGG - Intergenic
1121592388 14:95125739-95125761 AGGAAGACAGGGAGGGGAGGAGG + Intronic
1121645953 14:95516944-95516966 GGGGAGACAGACAGGGGCCAGGG - Intronic
1122374740 14:101250359-101250381 ATCTAGACAGAGGGGGGCCAGGG - Intergenic
1123112275 14:105878538-105878560 AGATAGAAAGAGAGAGCACACGG - Intergenic
1123193231 14:106591527-106591549 AGGCAGAGAGAGAGAGGAGAAGG + Intergenic
1123580509 15:21711168-21711190 AGTAAGACAGACAGGAGACATGG - Intergenic
1123617157 15:22153791-22153813 AGTAAGACAGACAGGAGACATGG - Intergenic
1124123118 15:26909393-26909415 AGGTAGGAAGAGTTGGGACATGG + Intronic
1124338565 15:28875457-28875479 AGGCAGCAAGAGAGAGGACATGG - Intergenic
1124655315 15:31502610-31502632 AGTCAGACTGAGAGGCGACAGGG + Intronic
1124865302 15:33484764-33484786 AGGAAGACAGAGGGAGGAGATGG + Intronic
1125180531 15:36877907-36877929 AGAAAGAGAGAGAGGGGAGAGGG + Intergenic
1125191685 15:37001037-37001059 AGGTCGACAGAGAAGGGTGAGGG - Intronic
1125307968 15:38343682-38343704 AGGTAGACACAGATTGTACAAGG + Intronic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1125749925 15:42021145-42021167 GGGTAGACAGATAGGGTGCATGG + Intronic
1125890078 15:43259073-43259095 AGGTAGAAAGAGAGGGAAGATGG + Intronic
1126420162 15:48464164-48464186 ATTTACACAGAGAGAGGACACGG - Intronic
1126582925 15:50257689-50257711 TGGTTGACAGAGAGTGGACCAGG - Intronic
1126880093 15:53085164-53085186 AGGTGGAAAGAGTGGGCACAGGG - Intergenic
1127186810 15:56488983-56489005 AGAGAGAGAGAGAGGGGAGAAGG + Intergenic
1127556159 15:60089495-60089517 AGGAAGAGTGAGTGGGGACAAGG - Intergenic
1128155382 15:65388643-65388665 AGGTGGGCAGGGAGGGGACTGGG + Intronic
1128363650 15:66981686-66981708 AGGCAGATAGAGAGGGGAACAGG + Intergenic
1128914119 15:71544104-71544126 GGGCAGATAGAGAGGAGACAGGG + Intronic
1128944972 15:71813800-71813822 TGGTTGACTGTGAGGGGACAGGG + Intronic
1129044985 15:72725994-72726016 AGGGAGAGAGGGAGGGGAAAGGG - Intronic
1129172378 15:73816183-73816205 AGGCACACAGAGAGAAGACAGGG + Intergenic
1129600867 15:76997230-76997252 AGCCAGACACAGAGGAGACAAGG - Intronic
1129739523 15:77983517-77983539 AGGAAGAAGGAGAGGGGAAAGGG + Intergenic
1129739935 15:77985270-77985292 AGGTAGCCAGACAGGGCACATGG - Intronic
1130273988 15:82466957-82466979 GGTTATACAGAGAGGAGACAGGG + Intergenic
1130466336 15:84194331-84194353 GGTTATACAGAGAGGAGACAGGG + Intergenic
1130497928 15:84479205-84479227 GGTTATACAGAGAGGAGACAGGG - Intergenic
1130533567 15:84766618-84766640 AGACAGAGAGAGAGAGGACAGGG + Intronic
1130588630 15:85198924-85198946 GGTTATACAGAGAGGAGACAGGG + Intergenic
1130940687 15:88506100-88506122 AGATTTACAGAGAGGGGAGAAGG + Intergenic
1130959927 15:88652622-88652644 AGGAGGAAAGGGAGGGGACAGGG - Intronic
1130997021 15:88909605-88909627 AGTTAGACCGAGGGGGGAAAAGG - Intronic
1131109848 15:89758402-89758424 GGGGAGACAGGCAGGGGACAGGG - Intergenic
1131126968 15:89866973-89866995 AGGGAGAGGGAGAGGGGAAAAGG - Intronic
1132150717 15:99456147-99456169 AGGGAGAAACAGAGGGGACGAGG + Intergenic
1202989379 15_KI270727v1_random:445413-445435 AGTAAGACAGACAGGAGACATGG - Intergenic
1133485581 16:6215314-6215336 AGAGAGACAGAGAGGGGAGGGGG + Intronic
1133507476 16:6426296-6426318 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1133601654 16:7345619-7345641 ATGTAGACAGAGAGGGGACTCGG - Intronic
1134193451 16:12140189-12140211 AGGGAAAGAGAGAGGAGACATGG - Intronic
1134199416 16:12185450-12185472 AGGAAGACAGAGAGGAGGGAGGG - Intronic
1134375320 16:13666762-13666784 AGGAGGAAAGAGAGGGGGCAAGG + Intergenic
1135097186 16:19574287-19574309 TGGTAGACAGAGGGAGGAAAGGG + Intronic
1135393891 16:22116432-22116454 AGGAAGAGAGAGAGAGGAGAAGG + Intronic
1137862341 16:51858679-51858701 AGGTACACAGGGAAGGGACAGGG + Intergenic
1138493048 16:57387883-57387905 AGGGAGAGAGAGAGGAGGCAAGG + Intergenic
1138750267 16:59410922-59410944 AGGTGGACAGAGAGTGCATAGGG + Intergenic
1138874379 16:60931346-60931368 ACTCAGACAGAGATGGGACATGG + Intergenic
1139199627 16:64960706-64960728 AGGTAGCAAGAGAAAGGACATGG + Intronic
1139295240 16:65895016-65895038 AGTGATACAGAGAGGAGACAGGG + Intergenic
1139310796 16:66026452-66026474 TGGGAGACAGAGCAGGGACAAGG + Intergenic
1139335054 16:66225843-66225865 AGGCAGCCAGAGTGGGGACCTGG - Intergenic
1139431358 16:66912613-66912635 GGGTAGGAACAGAGGGGACAGGG + Intronic
1139911654 16:70400998-70401020 AGGGAGAATGAGAGGAGACAAGG - Intronic
1140062346 16:71581778-71581800 AGGTTGACACAGAGGAGACTGGG - Intergenic
1140089110 16:71822389-71822411 AAATAAACAGAGAGGGGAAAAGG + Intergenic
1140145172 16:72300067-72300089 AGGTAGAAAGAGAAGGGGGATGG - Intergenic
1140251983 16:73302282-73302304 AGGGAGAGAGAGAGGAGAAAGGG - Intergenic
1140304506 16:73790516-73790538 AGGTGGAAAGAGAGGAGAAATGG - Intergenic
1140320875 16:73950641-73950663 AGTGAGGCAGTGAGGGGACATGG + Intergenic
1140865581 16:79058459-79058481 AGGAAGAGAGAGAGGGAAGAAGG + Intronic
1140938735 16:79701051-79701073 AGGGAGGAAGAGAGGGGGCAAGG - Intergenic
1141007178 16:80363306-80363328 AGGGAGAGAGAGAGGGGAGGAGG + Intergenic
1141307801 16:82882661-82882683 AGGGAGAGAGAGAGGGAAAAAGG - Intronic
1141796038 16:86274936-86274958 ACATACACAGAGAGGGGACATGG - Intergenic
1141826904 16:86486841-86486863 AGGAAGATAGAAAGGGGAAACGG + Intergenic
1142294625 16:89212296-89212318 AGGTGGAAAGGAAGGGGACAGGG - Intergenic
1143001118 17:3795609-3795631 TGGTAAACAGAGAGAGGCCAGGG + Intronic
1143277380 17:5721922-5721944 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1143377285 17:6474288-6474310 AGGTGGAAAGAGAGGAGAGAGGG - Intronic
1143635499 17:8162105-8162127 AGGGAGACAGGGATGGGGCATGG + Intronic
1143700935 17:8659513-8659535 AGACAGACAGAGAGGGGATGGGG - Intergenic
1143854469 17:9838510-9838532 AGGTAGACAGTGAGCAGAGAGGG - Intronic
1144022969 17:11253195-11253217 AGTCGGACAGAGAGGGGAGAAGG - Intronic
1144292051 17:13836204-13836226 AGCAAAAGAGAGAGGGGACAGGG + Intergenic
1144366407 17:14549129-14549151 AGGTGAACAGAGAGGGGAAGAGG + Intergenic
1144374476 17:14625954-14625976 AACTAGAAAGAGAGGGGACTTGG - Intergenic
1146400417 17:32496648-32496670 AGGTTGACAGAGGGGAGGCAGGG - Intronic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1147337999 17:39738577-39738599 AGGTGTACAGGGAGGGAACAAGG - Intronic
1147795957 17:43042980-43043002 AGGTAGACAGGGAGCTGGCATGG + Intergenic
1147952130 17:44113125-44113147 AGGCAGAGAGAGCTGGGACAGGG - Intronic
1147993889 17:44351021-44351043 AGGTGGCCTGAGTGGGGACAGGG - Exonic
1148473233 17:47909079-47909101 AGGGTGCCAGAGTGGGGACATGG - Intronic
1148772405 17:50075100-50075122 AGGCAGACAGAGCAGGGAAATGG + Intronic
1149042524 17:52206948-52206970 AAGTAGAAAGAAAGGAGACAAGG + Intergenic
1149053570 17:52335756-52335778 GGGGAGAGAGAGAGGGGAGAGGG - Intergenic
1149304622 17:55335790-55335812 AGGGAGATAGAGAGGGGTGAGGG - Intergenic
1149768522 17:59300869-59300891 AGGGAGACAGGGAGGGGGAAGGG - Intergenic
1151082548 17:71345284-71345306 AGAGAGACAGAAAGAGGACATGG - Intergenic
1151449786 17:74191529-74191551 AGGTGGACTGAGAGAGGACTGGG - Intergenic
1151523049 17:74644863-74644885 ATGAAGACACAGAGGGGTCAGGG - Intergenic
1151558917 17:74860657-74860679 GGGTAGGCAGAGAGGGCACTGGG - Intronic
1151819490 17:76489966-76489988 AGGGAGCCAGAGAGGGAACTTGG + Intronic
1152276892 17:79363225-79363247 TGATGCACAGAGAGGGGACATGG + Intronic
1152434769 17:80269345-80269367 AGGTGGACAGATAGGGTAGAGGG - Intronic
1152550787 17:81028862-81028884 AGGTGGACAGAGTGGGGACCTGG + Intergenic
1153066297 18:1049020-1049042 AGGTAGAAAGAAGGGGGAAATGG - Intergenic
1153338261 18:3947400-3947422 AGGCAGAGATTGAGGGGACAGGG - Intronic
1154477879 18:14782899-14782921 AGGAAGGCAGAGAGAGTACAGGG + Intronic
1155375563 18:25153376-25153398 AGGTAATAAGAGAGGGGGCAGGG - Intronic
1155416860 18:25607424-25607446 GGGTAGAGAGAGAGGGGGCTTGG + Intergenic
1155652104 18:28154790-28154812 AGGAAGAGAGTGAGGAGACAAGG - Intronic
1156024518 18:32636735-32636757 AGGGAGAAAAAGAGGGAACAGGG - Intergenic
1156163358 18:34386864-34386886 CTTTAGACAGAGAGGGTACATGG - Intergenic
1156337808 18:36186313-36186335 AGGCATACAGCGGGGGGACAAGG - Intergenic
1156521489 18:37725653-37725675 AGGTGGGCAGAGAGGAGAAAAGG - Intergenic
1156860736 18:41833468-41833490 TGGTTAACAGAGAGGGAACATGG - Intergenic
1157131672 18:45013230-45013252 AGGTAGGCAGGGTGGGGCCAAGG - Intronic
1157552076 18:48588932-48588954 ATGTAGAGAGGGAGGGGAAAGGG - Intronic
1157625196 18:49045146-49045168 GGGTGGGGAGAGAGGGGACAGGG + Intronic
1158497931 18:57973580-57973602 AGGGAGACAGAGAGGAGATGAGG - Intergenic
1159077067 18:63692536-63692558 AGGAAGTCAGAGAGGACACAAGG + Intronic
1159212176 18:65338503-65338525 AGGAAGACAGAGAGGAGAAGAGG - Intergenic
1160253995 18:77231982-77232004 AGGAAGAGAAAGAGTGGACAGGG - Intergenic
1160287292 18:77555987-77556009 AGATAGACAGATAGAGGATATGG + Intergenic
1161017821 19:1991856-1991878 AGGTAGACAGAGCAGGGCCAGGG - Intronic
1161035153 19:2080262-2080284 GGGGAGTCAGAGAGGGGAGAGGG + Intronic
1161178069 19:2859672-2859694 ATGTAGACAGTGAGGGCTCAGGG + Exonic
1161756578 19:6138467-6138489 AGGGAGAGAGAGAGGGGAAGGGG + Intronic
1161845635 19:6710552-6710574 AGAGAGAGAGAGAGGAGACAGGG + Intronic
1162566140 19:11446641-11446663 AAGGAGACAGACAGGGGACGAGG - Intronic
1162897703 19:13775187-13775209 AGGAAGACAGCGAGGTGACATGG + Intronic
1163025011 19:14505797-14505819 AGGAAGACAGAGCTGGGACCTGG - Intergenic
1163186002 19:15640237-15640259 AGGAGGACAGAGCGGGGACGTGG - Intronic
1163223067 19:15935493-15935515 AGGAGGACAGAGAGGGGAGATGG + Intergenic
1163776987 19:19224662-19224684 AGGGAGGCAGGCAGGGGACAGGG - Intronic
1164802378 19:31088259-31088281 AGGGAGGAAGAGAGGGGAGAGGG + Intergenic
1164840299 19:31388065-31388087 AGGGGGACAAAGAGGGGACAGGG + Intergenic
1164927585 19:32142309-32142331 AGGGAGAGAGAGAGGAGAGAGGG - Intergenic
1165381862 19:35487465-35487487 AGCTAGAGGGAGAGGGGTCAGGG + Exonic
1165381889 19:35487628-35487650 TGGGAGAGAGAGTGGGGACAGGG - Intronic
1165898701 19:39158378-39158400 AGGTAGACAGTGAGAGGGCTTGG + Intronic
1166090429 19:40504952-40504974 AGAGAGACAGAGAGAGGAGAAGG + Intronic
1166090431 19:40504972-40504994 AGGCAGACACAAAGGTGACATGG + Intronic
1166258345 19:41621105-41621127 GGGTGGAGAGAGAGAGGACAAGG - Intronic
1166678043 19:44751196-44751218 TGGAGGACAGAGAAGGGACATGG - Intronic
1166742540 19:45123091-45123113 AGGGAGGGAGGGAGGGGACATGG - Intronic
1167235339 19:48311229-48311251 AAGTCAAAAGAGAGGGGACAGGG + Intronic
1167588875 19:50391675-50391697 AGGGAGACTGAGAGGGGGGAGGG + Intronic
1167662845 19:50806158-50806180 ATGCAGGCTGAGAGGGGACAGGG - Intergenic
1167685551 19:50953507-50953529 AGAGAGACAGAGAGGCGAGAGGG - Intergenic
1168099497 19:54133783-54133805 AGGAAGAGAGAGAGGGGAGGTGG - Intergenic
1168099505 19:54133812-54133834 AGGGAGAGAGAGAGGGGAGGTGG - Intergenic
1168099514 19:54133843-54133865 AGGGAGAGAGAGAGGGGAGGTGG - Intergenic
1168297265 19:55383615-55383637 ATGGAGACAGAGAGCGGCCATGG - Intronic
925711040 2:6740329-6740351 AGAGAGACAGAGAGAGCACAGGG - Intergenic
925919076 2:8627079-8627101 AGGGAGAGAGAGAGGGGAAAGGG + Intergenic
926041551 2:9677438-9677460 AGATAGAGAGAGAGGGGATGCGG - Intergenic
926071174 2:9893226-9893248 AGGTAGACAGATAGGAAAAATGG - Intronic
926236000 2:11044491-11044513 AGGAAGACAGAGTGGGGAGGAGG - Intergenic
926350662 2:11991271-11991293 AGGGAGACAGAGAGGAGTCAGGG - Intergenic
927231668 2:20830024-20830046 AGAGAGAGAGAGAGAGGACAGGG - Intergenic
927497578 2:23561161-23561183 AGGCAGAGACAGAGGGGAGAGGG - Intronic
927980997 2:27375159-27375181 AGGAAGACAGAGAGGAGGCAGGG - Intronic
928003412 2:27541403-27541425 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
928775787 2:34761705-34761727 AGGTAGACAGAGGGAGGCTAAGG - Intergenic
928924143 2:36559731-36559753 AGGTAGCCAGAGAGCGGGCCAGG - Intronic
929312856 2:40445718-40445740 AGGCAGACAGGGAGGAGTCAGGG + Intronic
929399805 2:41566915-41566937 AGGGAGACAGGGAGGAGGCAGGG - Intergenic
929802936 2:45119809-45119831 AGGTAGACAGAAAGAGGAAGAGG - Intergenic
929848600 2:45559065-45559087 AGGTAGACAGGGGCAGGACAAGG - Intronic
930740910 2:54831777-54831799 AGGGAGTCGGAGAGGGCACAGGG + Intronic
931135579 2:59395861-59395883 AGGTAGTAAGAGAGAAGACAAGG - Intergenic
931578837 2:63751637-63751659 AGAGAGCCAGAGAAGGGACATGG - Intronic
931832847 2:66070394-66070416 AGCAAGACACAGAGGGGAGAAGG - Intergenic
931868779 2:66438232-66438254 AAGGAGTCTGAGAGGGGACAAGG - Intronic
932664514 2:73686061-73686083 GGGGAGACAGAGAGAGGAGATGG - Intergenic
933060011 2:77725280-77725302 AGGAAGAAAGGGAGGGGAAAAGG + Intergenic
933738573 2:85515132-85515154 AGGAAGACAGTGAGGGGACCAGG + Intergenic
934542144 2:95184516-95184538 ATGGAGACAGAGTGGGGATATGG + Intergenic
935081764 2:99804891-99804913 AGGTATACAGAGTGGGAAAATGG + Intronic
935151320 2:100439435-100439457 AGGAAAAAAGAGAGGGGAAAGGG - Intergenic
935210226 2:100933294-100933316 AGGTAGGTAGAGAGAGGAGAAGG + Intronic
935529507 2:104215600-104215622 AGGTAGATAGAGAGGAAAAAGGG + Intergenic
935675245 2:105589584-105589606 AGGGAGACACATAGGAGACAGGG - Intergenic
936252827 2:110880255-110880277 ATGGGGACTGAGAGGGGACAGGG - Intronic
936396583 2:112136562-112136584 AGAGAGACAGAGAGGGAGCAGGG + Intergenic
937007432 2:118530137-118530159 AGGTGGTCAGAGAGAGGGCAGGG - Intergenic
938126834 2:128680344-128680366 AGGAAGAAAGAGAGGGGGGAGGG - Intergenic
938593113 2:132758715-132758737 AGGTAGACAGGAAGAGGACTGGG + Intronic
939116437 2:138067042-138067064 AGGGAGGCAGAGAGAGAACAGGG - Intergenic
939186995 2:138872362-138872384 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
942922435 2:181392580-181392602 AGGTTCAAAGGGAGGGGACATGG + Intergenic
943575760 2:189629325-189629347 AGGTGAACAGAGAGAGGTCAGGG - Intergenic
944349430 2:198709428-198709450 AGAGAGACGGAGAGGGGAAAGGG - Intergenic
944584644 2:201162688-201162710 AGGCACACAGGGAGAGGACAAGG + Intronic
945187360 2:207152884-207152906 AGGTGGAAATAGTGGGGACAGGG + Intronic
946236645 2:218328393-218328415 ATAAAGCCAGAGAGGGGACAGGG - Intronic
946880667 2:224174281-224174303 AGCTGGACAGACAGGGGCCAAGG - Intergenic
947931444 2:233968315-233968337 AGTGAGACAGGGAAGGGACAGGG + Intronic
948064292 2:235065112-235065134 AGGCAGGCAGAGGGGGGATAGGG + Intergenic
948295470 2:236857190-236857212 AGGGAGACAGAGAGGAGACAGGG - Intergenic
948661998 2:239513300-239513322 AGATAGAGAGAGAGAGGAGAAGG - Intergenic
949064941 2:241984305-241984327 AGAGAGACAGAGAGGAGAGAGGG + Intergenic
1169052811 20:2595021-2595043 AGGTAGGCATAGAGTGGCCAGGG - Intronic
1169282349 20:4278409-4278431 AGGAAGAGGGAGATGGGACAGGG - Intergenic
1169444085 20:5657087-5657109 AGATAGCAAGAGAGGGCACAGGG + Intergenic
1169541603 20:6606016-6606038 AGGTAGAAAGAGAGGGAAGGAGG - Intergenic
1171054860 20:21896473-21896495 AGGTAAACGGAGAGGTGAAATGG - Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172182648 20:33012958-33012980 AGGGATACAGTGAGGGGACGGGG + Intronic
1172442653 20:34977053-34977075 AGGGAGAGAGAGAGGGGGGAGGG - Intronic
1172740330 20:37161451-37161473 AGGGAGAGAGAGAGGAGAAATGG + Intronic
1172989322 20:39021240-39021262 AGGAAGTCCGAGAGGGGACAGGG - Intronic
1173005086 20:39134153-39134175 AGGGAGACAGAGAGGGAAGGAGG - Intergenic
1173115173 20:40235007-40235029 AGGAAGGAAGGGAGGGGACATGG + Intergenic
1173226322 20:41164290-41164312 AGGCTGAGGGAGAGGGGACAGGG - Intronic
1173303762 20:41828669-41828691 AGGCAGACAGAGATGGGTCCTGG + Intergenic
1173342713 20:42167278-42167300 AGGAAAGCAGAGAGGAGACAAGG - Intronic
1173615626 20:44401264-44401286 AGGAAGGCAGAGAGGGCACTGGG + Exonic
1173768838 20:45640202-45640224 AGCAAGAGAGAGAGGGGGCAGGG + Intergenic
1173841898 20:46162942-46162964 AGGAAGCCTGAGAGGGGAAAGGG + Intergenic
1174082683 20:47982285-47982307 ACCAAGACAGAGAGGAGACAGGG - Intergenic
1174140666 20:48411242-48411264 AGGGAGACAGAGAAGAGACGGGG + Intergenic
1174200638 20:48804341-48804363 AGGGAGACAGAGGGGGAGCATGG + Intronic
1174297750 20:49561143-49561165 AGGTAGAGAGGGAGGGGGAAAGG - Intronic
1174741086 20:53014965-53014987 AGGTAGGCAGAGGAGAGACAGGG - Intronic
1174812590 20:53659914-53659936 AGGGAAACGGAGAGGGGAGAGGG + Intergenic
1175223302 20:57430169-57430191 AGGTGAACAGAGAGGGGCCTGGG + Intergenic
1175599696 20:60263244-60263266 AGGTAGACAGAGGAGGGGAATGG - Intergenic
1175748122 20:61475649-61475671 AGGAAGAGAGAGAGGGGAGGCGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177748381 21:25250228-25250250 ATGTAGACAGAGAAGTGATAAGG - Intergenic
1177973017 21:27813759-27813781 AGGAAAAGAGAGAGGGGAAAAGG + Intergenic
1178495748 21:33084679-33084701 TGGAAGACGGAGAGAGGACAGGG - Intergenic
1178883105 21:36464164-36464186 AGGAAGAGAGAGAGGGGAGCAGG - Intronic
1179046221 21:37847757-37847779 AGGGAGAGAGAGAGGAGAGAAGG + Intronic
1179396553 21:41045552-41045574 AGGGAGACAGAAAGAGGACAGGG + Intergenic
1179726262 21:43343089-43343111 AGGCAGACAGTCACGGGACACGG + Intergenic
1180094746 21:45550829-45550851 AGGGAGGCAGGGAGGGGAGATGG - Intergenic
1181042822 22:20200636-20200658 ATGTAGGCAGAGTGGGGACAAGG + Intergenic
1182100861 22:27656319-27656341 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1182415385 22:30217943-30217965 AGGGAGACAGGGAGGGGAGGAGG + Intergenic
1182966794 22:34529040-34529062 AGGAAAACAGAGAGGTAACATGG + Intergenic
1183520741 22:38294873-38294895 TGGTACACAGAGGGGGGCCAGGG - Intronic
1183692094 22:39396261-39396283 AGGTAGACAGAGAGCGCAGGGGG - Intergenic
1183988954 22:41585169-41585191 AGATGGAGACAGAGGGGACAGGG + Intronic
1183994247 22:41621030-41621052 GAGGTGACAGAGAGGGGACAGGG + Exonic
1184176812 22:42793554-42793576 AGGTGGACAGACGGGGCACATGG + Intergenic
1184408019 22:44311199-44311221 AGGGAGACAGTGAGGGCCCAGGG - Intronic
1184420315 22:44378358-44378380 AGGGAGAGAGAGAGGGAAGAAGG - Intergenic
1184944075 22:47788577-47788599 AGGCAGGCAGAGACGGGGCATGG + Intergenic
1185079533 22:48701981-48702003 ATGTACACACAGAGGGGACCTGG + Intronic
1185120363 22:48962631-48962653 AGGTAGACACCCAGGGGCCAAGG + Intergenic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949607468 3:5670100-5670122 AGGTGGGGAGAGAGGGGATAAGG + Intergenic
949637728 3:6001990-6002012 AGAGAGAGAGAGAGGGGAAAGGG - Intergenic
949888372 3:8713994-8714016 AGGAAGACTGAGAGGGGGTAGGG + Intronic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950193246 3:10992440-10992462 AGGGAGGAAGAGAGGGGAGAAGG + Intergenic
950284239 3:11732315-11732337 AGGGAGAGAGAGAGGGAAAAAGG - Intergenic
950372178 3:12540342-12540364 AGGTAGACAGCAACTGGACAAGG - Exonic
950677881 3:14565523-14565545 AGGTAGGGAGAGAGGAGGCAGGG - Intergenic
950678435 3:14568700-14568722 AGGGAGACAGAGATGGGATGGGG + Intergenic
950796346 3:15513500-15513522 AGGGAGACAGGCAGGGGACTGGG - Intronic
950824919 3:15808384-15808406 AGGTAGAAAGCCAGGGGATAAGG - Intronic
950904384 3:16524578-16524600 AGAAAGAGAGAGAGGGGAGAGGG - Intergenic
951309521 3:21106695-21106717 GAGTGGACAGAGAGAGGACACGG - Intergenic
951987227 3:28634237-28634259 AGGTGGGGAGAGTGGGGACAGGG - Intergenic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952580643 3:34829790-34829812 GGGTAGATGGAAAGGGGACAAGG - Intergenic
952685766 3:36146666-36146688 ATGCAGAGAGAGAGGGGACAGGG + Intergenic
952820938 3:37485078-37485100 GGGAAAACAGAGAGGGGACAGGG + Intronic
953349320 3:42202767-42202789 AGGAGGACAGAGAGGGGCCGAGG - Intronic
953657430 3:44864769-44864791 AGGTAGACACAGCAGGTACATGG - Intronic
953789683 3:45937778-45937800 AGGAAGACAGAGAGGGGGTTGGG - Intronic
953892225 3:46760062-46760084 AGGAAGCAAGAGAGGGGACATGG - Intronic
954590418 3:51777738-51777760 GGGAGGCCAGAGAGGGGACATGG + Intergenic
954594635 3:51814153-51814175 GGGAGGCCAGAGAGGGGACATGG - Intergenic
955071809 3:55577960-55577982 AGGGAGAGAGAAAGGGGACGTGG + Intronic
955100144 3:55840945-55840967 AGATAGAGATAGAGGGGTCATGG + Intronic
955474825 3:59325941-59325963 AGGAAGAGAGAGAGAGGAGAAGG + Intergenic
956043096 3:65167421-65167443 AGGAAGACAGAGTGGAGATAAGG - Intergenic
956282984 3:67578531-67578553 AGCCAGAAAGAGAGGGGACAGGG + Intronic
957756322 3:84492774-84492796 AAGTAGAAAAAGAGGGAACATGG + Intergenic
958072480 3:88632232-88632254 AGCCATACAGAGTGGGGACATGG + Intergenic
958126505 3:89363196-89363218 AGAGAGATAGAGAGGGGGCAGGG + Intronic
959258167 3:104041359-104041381 AGATAAGCAGTGAGGGGACATGG - Intergenic
959512095 3:107225470-107225492 AGGGAGATGGAGAGGGGAGAGGG - Intergenic
959563646 3:107812160-107812182 AGGGAGAGAGAGAGAGAACATGG + Intergenic
959584474 3:108013382-108013404 AGACAGACAGAGAAGGGAGAAGG + Intergenic
959889968 3:111543777-111543799 AGCTAGACAGAGATGGGGTAAGG - Intronic
960196203 3:114771743-114771765 ACGTGGACAAAGAGGGGATAAGG - Intronic
960396971 3:117149681-117149703 AGGCAGACACAGAGGGGACTTGG + Intergenic
960577316 3:119241927-119241949 AGGGAGACAGAGAGGGGGAGGGG - Intergenic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
962870742 3:139490549-139490571 AGGTAGAGAGAGAGGGATAATGG - Intergenic
963167795 3:142223484-142223506 AGCTAGCCAGAGAAGGGACCAGG + Intronic
963533769 3:146502770-146502792 AGCAAGAGAGAGAGGGGAGAAGG - Intergenic
963911868 3:150822062-150822084 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
964888169 3:161508576-161508598 ATGAAGACAGAGAGGACACATGG - Intergenic
964903096 3:161684784-161684806 AAGAAGACAGAGAGAAGACAGGG - Intergenic
965169390 3:165241830-165241852 AGCTAGACAAAGAAGGTACAGGG - Intergenic
965355441 3:167667338-167667360 AGGGAGGGAGAGAGGGGACAGGG + Intergenic
966578147 3:181527177-181527199 AGAGAGACAGAGAGGGGGGAAGG + Intergenic
966919544 3:184602774-184602796 AGGAACACAGAGAGGGAACAAGG - Intronic
967273575 3:187751273-187751295 AGGGAGGCAGAGAGGAGAGAAGG + Intergenic
968478247 4:822712-822734 AGCAAGACAGAGATGGGAAATGG - Intronic
968570495 4:1338016-1338038 AGTTCCACAAAGAGGGGACAAGG - Intronic
968613457 4:1567271-1567293 AGGGAGAGAGGGAGGGGGCAAGG + Intergenic
968985161 4:3871126-3871148 AGACAGAGAGGGAGGGGACAAGG + Intergenic
969232103 4:5839161-5839183 AGGGAGACAGAGAGATGTCACGG + Intronic
969301785 4:6301305-6301327 AGGTAGACATAGAGCAGGCACGG - Exonic
969562572 4:7959023-7959045 AGGCAGACTGATAGGGGAAAAGG - Intergenic
969698761 4:8753629-8753651 AGAAAGAGAGAGAGGAGACAGGG - Intergenic
970124485 4:12793598-12793620 AGGTAGAAAAAGATGTGACACGG - Intergenic
970155987 4:13142268-13142290 AGGGAGAGAGGGAGGGGAGAAGG + Intergenic
971013965 4:22468469-22468491 ACGAAGACAGAGATGGGACTCGG + Intronic
971287836 4:25307594-25307616 AGGCAGGAAGACAGGGGACAGGG + Intergenic
971417805 4:26449578-26449600 AGGTAGACAGAGTGGAAAAATGG + Intergenic
971626206 4:28923250-28923272 AGGGAGAAAGAGAGGGGAGATGG - Intergenic
971650953 4:29273543-29273565 GCGGAGGCAGAGAGGGGACATGG - Intergenic
971973536 4:33652701-33652723 AGAAAGACAATGAGGGGACAGGG + Intergenic
972579446 4:40381723-40381745 AGGTAGAGAGAGAGAGATCAGGG + Intergenic
973163898 4:47053086-47053108 AGGTAAAGGGAGAGGTGACATGG + Intronic
973833206 4:54782691-54782713 ACAAAGACAGAGAGGAGACAGGG + Intergenic
974431801 4:61807957-61807979 AGTGAGACAGATAAGGGACAGGG - Intronic
974558614 4:63487554-63487576 AGGCAGCAAGAGAGGGAACATGG - Intergenic
974965815 4:68759813-68759835 GGGCAGCCAGAGAGGGGCCATGG + Intergenic
975627431 4:76363698-76363720 ATGAAGTCAGAGAGGGGCCAAGG + Intronic
976834593 4:89356773-89356795 AGGGAGAGAGACAGGGGAGACGG - Intergenic
977735660 4:100412160-100412182 AGAGAGACAGTCAGGGGACAGGG + Intronic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978582609 4:110247356-110247378 ATGTAGACACAGAGAGGAAAGGG - Intergenic
980450014 4:132958703-132958725 AGGTGGGCAGAGAGGGGCCCTGG + Intergenic
980596311 4:134959858-134959880 GGGTAGAGAGAGTGGGGACTTGG - Intergenic
981223896 4:142269067-142269089 ATGTCCACAGGGAGGGGACAAGG + Intronic
981300834 4:143184794-143184816 AGGGAGGGAGAGAGGGAACAAGG + Intergenic
982658031 4:158173199-158173221 AAGAAGACAGAAAGGGGACAGGG + Intronic
984466284 4:180102645-180102667 ACAAAGACAGAGAGGAGACAAGG - Intergenic
985202083 4:187494331-187494353 AGGAAGAGAGGGAGGGGGCAGGG - Intergenic
985920297 5:2966345-2966367 AGGGAGCCAGTGAGGGGAGATGG - Intergenic
985950575 5:3219076-3219098 AGGTAGACTGTGAGGAGACCAGG - Intergenic
986003248 5:3646881-3646903 AGGGAGAGAGAGAGGGGGCAAGG + Intergenic
986161861 5:5237414-5237436 AGGAAAATAGAGAGGGGACGTGG + Intronic
986538862 5:8822359-8822381 AGAGAGAGAGAGAGGGCACAGGG - Intergenic
987017462 5:13835318-13835340 AGGCAGATAGAGAGGGTAAAAGG + Intronic
987135853 5:14898758-14898780 AGGAAGAGAGAGAGGGGTCTGGG + Intergenic
987259356 5:16187956-16187978 ATGTAGACATGGAGGGGACGTGG + Intergenic
987425597 5:17769170-17769192 ATATAGACAGAGAGTGGTCAAGG - Intergenic
987772199 5:22319861-22319883 AGGAAGAGAGAGAGAGGAGAAGG + Intronic
987782322 5:22455026-22455048 AGGTAAACAGAGTGAGGATATGG + Intronic
988563363 5:32300578-32300600 TGGCAGACAGAGAGGGGGTATGG - Intronic
988786716 5:34571868-34571890 ACGTAGACACACAGGGGAGAAGG - Intergenic
988801189 5:34698134-34698156 AGGGAGGCAGAGAGGGGAGGGGG - Intronic
988941385 5:36151634-36151656 AGGCGGAAAGAGAGGGGACCCGG - Exonic
989566833 5:42909429-42909451 AAGCAGACAGAAAGGGGGCAGGG - Intergenic
989567563 5:42916260-42916282 AAGCAGACAGAAAGGGGACAGGG + Intergenic
991460139 5:66849424-66849446 GGGTAAAGAGAGAGGGGAAAGGG - Intronic
991522994 5:67521496-67521518 AGGAAGAAAGAGAGGGAAGAAGG - Intergenic
991982129 5:72243103-72243125 GGGTAGACAGAGATGGGAGAGGG + Intronic
993781022 5:92065471-92065493 TGGAAGACAGAGAGGGAGCATGG - Intergenic
994699684 5:103118606-103118628 AGGTAGAGAGACAGATGACAAGG + Intronic
994901192 5:105771674-105771696 AGGTAGAGGGAGAGTGGAGAAGG + Intergenic
995063422 5:107835708-107835730 GGGTGGAAAGAGAGGGGAGAAGG + Intergenic
995328380 5:110918228-110918250 GGGTACAGAGAGAAGGGACAAGG + Intergenic
996069418 5:119117703-119117725 AAGTAGACAGAAAGAGGAGAGGG + Intronic
996437098 5:123446520-123446542 AGGGAGACGGAGTGAGGACAGGG + Intergenic
997124623 5:131213231-131213253 AGATAGAGAGAGAGGGAAAAGGG + Intergenic
997590833 5:135071215-135071237 AGGCAGGTAGACAGGGGACAGGG - Intronic
998222082 5:140291359-140291381 AGATTGAAAGAGAGGGGCCAAGG + Intronic
998428298 5:142048622-142048644 AGGTCTACAGAGAGAGGTCAGGG + Intergenic
998476252 5:142424549-142424571 AGGGAGTCTGAGAGGGGAGATGG - Intergenic
998579002 5:143350394-143350416 ATGTGCACAGAGAGGGGAAAAGG + Intronic
998762963 5:145452743-145452765 AGGAAGAAAGAGAGGTGAGAAGG + Intergenic
998938933 5:147260263-147260285 AGAGAGACAGAGAGGGGAGAGGG - Intronic
998997301 5:147879654-147879676 AGGAAGACAGTGTGGGCACATGG + Intronic
999177799 5:149643726-149643748 AGAGAGACAGAGAGGACACAAGG + Intergenic
999208734 5:149869468-149869490 AAATAGAAAGGGAGGGGACACGG + Intronic
999255091 5:150205637-150205659 AGGAAGGCTGAGAGTGGACAGGG - Intronic
1000419585 5:161023069-161023091 AAGTAGAGAGAGAGGGAATAAGG + Intergenic
1000993487 5:167935090-167935112 AGCTAGACAGCAATGGGACAAGG + Intronic
1001151017 5:169227103-169227125 TGGAAGACACAGAGGAGACAGGG + Intronic
1001266847 5:170279961-170279983 AGGGAGAGAGAGAGGGGGGAAGG + Intronic
1001397808 5:171429277-171429299 AGGAAGACACAGAGAGGCCACGG - Intronic
1002100644 5:176855925-176855947 AGGAACACAGCGAGGGGCCAGGG - Intronic
1002180619 5:177429274-177429296 AGGGACACTGAAAGGGGACAGGG + Intronic
1002446500 5:179293436-179293458 AGCTAGACAGATAGGGAACATGG + Intronic
1002899484 6:1399084-1399106 AGAGAGACAGAGAGAGGAAAAGG + Intergenic
1003016033 6:2468215-2468237 GGGTAGACAGAGAGAGGAAGGGG + Intergenic
1003016084 6:2468522-2468544 AGGGAGAGAGAGAGGGAGCAAGG + Intergenic
1003136028 6:3435358-3435380 AGGGAGACGGAGAGGGGAAGGGG - Intronic
1003607591 6:7577970-7577992 AGGAAGACAGGCAGGAGACAGGG - Intronic
1003728674 6:8794943-8794965 AGAAAGACAAAGAGGGGACATGG - Intergenic
1003747293 6:9016939-9016961 AGAGAGAAAGAGAGGAGACAGGG - Intergenic
1004545614 6:16595669-16595691 AGGCAGGCAGTGAGGGGAGAGGG + Intronic
1005225136 6:23634013-23634035 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1005809394 6:29504652-29504674 AGCCAGATAGAGAGGGAACAGGG - Intergenic
1006390374 6:33754720-33754742 CTGTAGACAGTGAGGGGACTGGG + Intergenic
1006458070 6:34143351-34143373 AGGAAGTGAGAGAGGGGACAAGG + Intronic
1006935587 6:37715446-37715468 GGGAAGAAAGAGAAGGGACAGGG - Intergenic
1007246816 6:40469125-40469147 AGACACACAGAGAGGGGAAAAGG + Intronic
1007372008 6:41432235-41432257 AGAGAGGCAGAGAGGAGACAGGG - Intergenic
1007836575 6:44678591-44678613 GAGGAGACAGAGAGGGGATAAGG - Intergenic
1008603179 6:53115666-53115688 AGGCAGACAGAGTGGTGAGAAGG - Intergenic
1008624986 6:53306353-53306375 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
1008624994 6:53306379-53306401 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
1008748712 6:54706371-54706393 AGATAGAGAGTGAGGGGAAATGG + Intergenic
1008935413 6:56986927-56986949 ATCTAGACAGAGAGGCCACAAGG - Intronic
1009604309 6:65847675-65847697 AGGAAGAAAGAGAGAGGAAAGGG + Intergenic
1009761547 6:68013037-68013059 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1010037892 6:71347063-71347085 AGGTAGACAGGGAGTCAACAAGG + Intergenic
1010181232 6:73088527-73088549 AGGTACACAGAAAGGGTCCAGGG - Intronic
1010994810 6:82520963-82520985 AGGTACACAGAGAGAGAAGAGGG - Intergenic
1011151713 6:84281166-84281188 AGGTAGTCAGGAAGGGGAGATGG - Intergenic
1012427905 6:99134413-99134435 AGATGGAAAGAGAGGGGAAAGGG + Intergenic
1012789426 6:103674889-103674911 TGATAGGCAGAGAGGGGGCATGG - Intergenic
1013023013 6:106238655-106238677 AGGCAGACAGAGAGAAGACCAGG + Intronic
1014630871 6:123788442-123788464 ATGTTCACAGAGAGAGGACAAGG + Intergenic
1015823064 6:137283347-137283369 ATGAGGGCAGAGAGGGGACAGGG - Intergenic
1016013618 6:139162999-139163021 AGGTAGACAGTGAGGTGAAAAGG - Intronic
1016088251 6:139942800-139942822 AGATAGACAGAGAGGGATAATGG + Intergenic
1016413092 6:143804237-143804259 AGATAGAGAGAGAGAGGCCAAGG - Intronic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1016705437 6:147101469-147101491 AGGTAGAAAGAAATGGGACCTGG + Intergenic
1017094821 6:150795496-150795518 ATGTAGACAGGGAGGGGAAGTGG - Intronic
1018417649 6:163615009-163615031 AGCCAGAGAGAGAGGGGAGAGGG - Intergenic
1019573830 7:1726641-1726663 AGGTAGAGGGAGAAGGGACTTGG - Intronic
1019938007 7:4268940-4268962 AGGAAGACAGAGAGGTGCTATGG + Exonic
1020396162 7:7721006-7721028 AGGGAGACACAGAGGAGAAATGG + Intronic
1023058342 7:36307437-36307459 AGGTGGCCAGAGAGAGAACAGGG - Intergenic
1023136817 7:37060872-37060894 AGGGAGGCACAGAGGGGAGAGGG + Intronic
1023589849 7:41770282-41770304 AGGTAAACAGTGAGAGCACATGG + Intergenic
1023696473 7:42852931-42852953 AGGAAGAAAGAGAGAAGACAAGG + Intergenic
1023937629 7:44750590-44750612 AGGCAGGCAGAGAGGTGGCATGG + Intronic
1024092952 7:45962309-45962331 AGATAGACAGAGAGGTACCAAGG - Intergenic
1024730068 7:52243831-52243853 AGTTAGACAGATTGGGGCCAAGG + Intergenic
1025014219 7:55425913-55425935 AGAGACACAGAGAGGGGCCAAGG - Intronic
1025108979 7:56196874-56196896 GGGAAGAGGGAGAGGGGACAGGG - Intergenic
1025269797 7:57499365-57499387 AAGTAGCCAGACAGGAGACAAGG - Intergenic
1026909210 7:74082999-74083021 AGGTAGACCTAGGGGGGACAGGG + Intronic
1026977075 7:74505489-74505511 AGGGACACAGAGAGGGAAGAGGG - Intronic
1027457594 7:78412939-78412961 AGGAAGACAGAGAGTAGAGATGG - Intronic
1028281550 7:88936032-88936054 AGGAAGAAAGAGAGGGAAGAGGG - Intronic
1028742624 7:94293382-94293404 AGGGAGACAGGGAGGAGAGAAGG - Intergenic
1029495047 7:100892081-100892103 AGGTAGACATGGAGGGGGCGGGG - Intronic
1030583337 7:111386568-111386590 AGGCAGACAGAGAGAGGGAATGG + Intronic
1031414497 7:121479387-121479409 GGGTGGAGAGAGAGGGGAGAGGG + Intergenic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1032074042 7:128827880-128827902 AGGAAGCCAGGGAGGGGAGAAGG - Intergenic
1032436785 7:131907328-131907350 AGGTAGAGTGAGAGGGCAAAGGG + Intergenic
1032608315 7:133382912-133382934 AGACAGACAGTGAGGAGACAAGG + Intronic
1032970108 7:137151306-137151328 AGGTAGCCAGAGAGGAGAAGAGG + Intergenic
1033756017 7:144398859-144398881 AGATAGACACAGAGAGGAGAGGG - Intronic
1034051467 7:147988649-147988671 AGGCACCCAGAGAGAGGACATGG - Intronic
1034404966 7:150897061-150897083 AGCTAGATAGGGAGGGGGCAGGG - Intergenic
1034844876 7:154435227-154435249 AGAGAGACAGAGAGAGAACAAGG + Intronic
1035082434 7:156228173-156228195 AGGTACACAGAGAAGAGAAATGG + Intergenic
1035237609 7:157508999-157509021 AGAAAGAGAGAGAGGAGACAGGG + Intergenic
1035237719 7:157509362-157509384 AGAGGGAGAGAGAGGGGACAGGG + Intergenic
1035607782 8:940377-940399 AGGGAGAGAGAGAGGGAAAAGGG + Intergenic
1035638611 8:1165135-1165157 AGGAAGACAGAGAGGGGGAGAGG + Intergenic
1035677323 8:1464639-1464661 AGGCAGATAGAGGGGAGACAGGG + Intergenic
1036630908 8:10514363-10514385 AGGCAGACAGTGAAAGGACAGGG + Intergenic
1037573213 8:20176257-20176279 AGGAAGAAAGAGAGAGGAGAGGG - Intronic
1037573320 8:20177357-20177379 AGGAAGACAGAAAGTAGACAAGG + Intronic
1037618243 8:20540538-20540560 TGGAAGTCAGAGAGGGGTCATGG + Intergenic
1037764213 8:21762005-21762027 AGGTAGCCAGAGAGGTGAGATGG - Intronic
1038249185 8:25887040-25887062 AGACAGACAGAGACAGGACAGGG - Intronic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1038316017 8:26484988-26485010 AGGAAGACAGAGAGCGAAGAGGG - Intronic
1038416930 8:27403955-27403977 AGATAGACAGAGAGAGGAGGAGG - Intronic
1038649096 8:29386154-29386176 AGGTAGGCACAGAGGGGAAAGGG - Intergenic
1039409695 8:37342373-37342395 AGGGGGACAGGGAGGGGAGAGGG + Intergenic
1040288225 8:46111206-46111228 AGGTAGGCAGAGAGGAGAAGTGG - Intergenic
1040299093 8:46178728-46178750 AGGCAGACAGAAGGGAGACATGG - Intergenic
1040300183 8:46183925-46183947 AGGCAGGCAGAGAGGGGAAGTGG - Intergenic
1040301249 8:46189128-46189150 AGGCAGACAGAGAGGAGAAGTGG + Intergenic
1040301954 8:46192654-46192676 AGGCAGACAGAGGGGAGACACGG + Intergenic
1040303767 8:46201615-46201637 AGGCAAGCAGAGAGGGGACACGG + Intergenic
1040314074 8:46251726-46251748 AGGCAGACAGAGGGGAGACGTGG + Intergenic
1040318394 8:46276839-46276861 AGGCAGACAGAGAGGAGAAGAGG - Intergenic
1040331281 8:46387037-46387059 AGGTAGACAGAGGGGAGAAGCGG + Intergenic
1041325360 8:56657836-56657858 AGATAGACTGAGAGGAGAAATGG + Intergenic
1042386626 8:68183214-68183236 GGGTATACAGAGAAAGGACATGG + Intronic
1042426178 8:68651050-68651072 AGGCAGATAGAGAGGGTAAAAGG - Intronic
1043427625 8:80164057-80164079 AGACAGACAGAAAGGGGAAAGGG + Intronic
1043925083 8:86027695-86027717 GGGGAGACAGGGAGGGGTCAGGG - Intronic
1044604663 8:94038259-94038281 AGGTAGTCAGAGATGAGATAGGG - Intergenic
1044824508 8:96183574-96183596 AGGTGGAGAGAGCTGGGACAAGG - Intergenic
1044826165 8:96199330-96199352 GGGTAGGCAGAGAGGGGAGCAGG - Intergenic
1044958497 8:97506142-97506164 AGGGAGGCAGAGGGGGGCCAGGG + Intergenic
1045329918 8:101146751-101146773 GGGTAGAAACAGAGAGGACAAGG + Intergenic
1045377597 8:101590674-101590696 AGGTATAAAGAGAAGGAACATGG - Intronic
1045900467 8:107273252-107273274 GGGTAGATAGAGAGAGGAGAGGG + Intronic
1047287502 8:123500728-123500750 AGGTAGAGAGGGAGGGGGAAAGG - Exonic
1048165607 8:132059061-132059083 AGGGAGAAAGAGAGGGTAGAAGG - Intronic
1048182073 8:132204549-132204571 AGGAGGAGAGAGAGGAGACAGGG - Intronic
1048350205 8:133609769-133609791 AGGTAGGTAGAGAAGGAACATGG + Intergenic
1048379223 8:133849570-133849592 AGGATGACAGAGATGGGAGAAGG + Intergenic
1048842285 8:138576679-138576701 ATGCAGAAAGAGAGGGGAGAGGG + Intergenic
1049030837 8:140036257-140036279 TGGAAGACAGACTGGGGACAAGG + Intronic
1049057950 8:140254019-140254041 AGGGGGACAGGAAGGGGACATGG + Intronic
1049149192 8:141023452-141023474 AGGGAGACAGGGAGGGGACGGGG - Intergenic
1049210782 8:141385508-141385530 AGGAAGGCAAAGAGGAGACAGGG - Intergenic
1049296511 8:141843290-141843312 AGGTAGAAATAGTGGGGCCAGGG - Intergenic
1049319438 8:141988160-141988182 AGGAACACAGAGAGGGGTCCAGG - Intergenic
1049337413 8:142093786-142093808 AGGTGGCCAGAGAGGGAACGGGG + Intergenic
1049404189 8:142444341-142444363 AGGAAGACAGAGAGGACCCAGGG - Intergenic
1049713576 8:144078694-144078716 AAGTAGGCAGAGAGCGGACCTGG + Exonic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1050475051 9:6032302-6032324 AGATAGAGAGAGAGAGGATAAGG + Intergenic
1050663297 9:7907563-7907585 AGGAACACAGAGGTGGGACAGGG - Intergenic
1051336580 9:16071134-16071156 AGGGAGGCAGAGAGAGGAGATGG + Intergenic
1051843853 9:21429629-21429651 AGGGAGAGAGAGAGAGGACCAGG - Intronic
1052490517 9:29161036-29161058 AGATGGACAGAGAGGAGCCAGGG + Intergenic
1052854421 9:33398277-33398299 AGATGGGCAGAGAGGGGCCAGGG + Intronic
1052878957 9:33588409-33588431 AGCAAGACAGAGAGAGGAGAAGG - Intergenic
1052961814 9:34304508-34304530 AGGTAGACAGTGATTGGATAGGG + Intronic
1053185115 9:36009445-36009467 AGAAAGAAAGAAAGGGGACAAGG + Intergenic
1053578896 9:39382418-39382440 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1053682426 9:40494438-40494460 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1053843411 9:42210493-42210515 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1053932409 9:43122764-43122786 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054100479 9:60941222-60941244 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1054121876 9:61216847-61216869 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1054281288 9:63130491-63130513 AGATGGGCAGAGAGGGGCCAGGG - Intergenic
1054295525 9:63329938-63329960 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054393545 9:64634442-64634464 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054428194 9:65139656-65139678 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054502186 9:65881888-65881910 AGATGGGCAGAGAGGGGCCAGGG - Intronic
1054585868 9:66965664-66965686 TGGTAGACAGTGAGGGGAGGGGG - Intergenic
1054916051 9:70496359-70496381 AGGTGGAGAGAGAGGGGACCTGG - Intergenic
1056032454 9:82567246-82567268 AGGAAGAAAGAGAGGGAAGAAGG + Intergenic
1056101745 9:83306394-83306416 AGGTAGAAAAAGAGGTGATAAGG - Intronic
1057340691 9:94198641-94198663 AGGTAGATTGGGAGGGGGCATGG - Intergenic
1057416061 9:94863240-94863262 AGGGAAACAGAGAGAGGAGAGGG - Intronic
1058220060 9:102288431-102288453 AGGTAGAGAGAAAGGGCAAAAGG - Intergenic
1058368463 9:104236052-104236074 CGGTAGAAAGAAAGGGGAGAGGG + Intergenic
1059001759 9:110356055-110356077 AGGAAGAGAGAGAAGGGGCAGGG - Intergenic
1059550327 9:115222704-115222726 AGGTAGACAAAGAGGTGATAAGG - Intronic
1059585022 9:115596570-115596592 AGGAAGAAAGAAAGGGGGCAGGG + Intergenic
1059803503 9:117774044-117774066 AGGAAGAAAGAGAGGGGAGAAGG - Intergenic
1060231264 9:121827233-121827255 ACCTAAACAGAGAGGGGAGAAGG - Intronic
1060243104 9:121921707-121921729 AGTTAGACAAAGAGGGAGCAGGG + Intronic
1060625391 9:125107807-125107829 AGGGAGATGGAGAGGGGAGAGGG - Intronic
1060686876 9:125622815-125622837 GGGGAGACGGAGAGGGGAGAGGG - Intronic
1061105828 9:128529681-128529703 AGGGAGAGAGAGAGAGGAAAGGG - Intronic
1061216569 9:129225193-129225215 AGGGGGAGAGGGAGGGGACAGGG - Intergenic
1061406386 9:130394976-130394998 AGGCGGGCAGAGAGGGGCCAGGG + Intronic
1061996627 9:134189428-134189450 AGGGAGAGAGAGAGATGACAGGG + Intergenic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1062683732 9:137799219-137799241 AAGGGGACAGGGAGGGGACAAGG - Intronic
1185461852 X:336567-336589 ACGTACACAGAGAGGTGAAAAGG + Intronic
1185619477 X:1444672-1444694 AGGGAGAGAGAGAAAGGACAGGG - Intronic
1185619703 X:1446177-1446199 AGGCAGAGAGAGAGAGGAGAAGG - Intronic
1185679152 X:1874045-1874067 AGGAAGAGAGAGAGGGAAGAAGG - Intergenic
1185683854 X:1910875-1910897 AGAGAGACAGAGAGGGAAGAAGG - Intergenic
1185683868 X:1910960-1910982 AGAGAGACAGAGAGGGAAGAAGG - Intergenic
1185683881 X:1911046-1911068 AGAGAGACAGAGAGGGAAGAAGG - Intergenic
1185683895 X:1911131-1911153 AGAGAGACAGAGAGGGAAGAAGG - Intergenic
1185683908 X:1911217-1911239 AGAGAGACAGAGAGGGAAGAAGG - Intergenic
1185683921 X:1911303-1911325 AGAGAGACAGAGAGGGAAGAAGG - Intergenic
1185708506 X:2282839-2282861 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1185975773 X:4718629-4718651 AGAGAGAGAGAGAGGGGAGAGGG + Intergenic
1186212534 X:7264538-7264560 AGGTAGACAAAGAAGGGAAAAGG + Intronic
1186362147 X:8853262-8853284 AGGTAGATAGATAGGATACATGG + Intergenic
1186434474 X:9531232-9531254 AGGGAGAGAGGGAGGGGAGAGGG + Intronic
1186473114 X:9836520-9836542 AGGGAGAGAGAGAAGGGAGAAGG - Intronic
1186803364 X:13115511-13115533 AGGTAGAAATAGCAGGGACAGGG + Intergenic
1188368150 X:29335266-29335288 ACGGAGACGGAGAGGGGAGAGGG + Intronic
1188459107 X:30402480-30402502 AGATAGCCCTAGAGGGGACATGG - Intergenic
1189075953 X:37914579-37914601 GGGGAGACAGAGATGGGATAAGG + Intronic
1189088576 X:38053282-38053304 AGGTAGTAAAAGAAGGGACATGG + Intronic
1189169867 X:38898521-38898543 AGGAAGGCAGAGAGGAGAAAGGG + Intergenic
1189198922 X:39175281-39175303 AGACAGACAGAGAGAGGAAAGGG + Intergenic
1189222102 X:39381345-39381367 AGGTAGATAGAGAGGGAAGGAGG - Intergenic
1189313990 X:40040828-40040850 AGAGAGAAAGAGAGGGGACAAGG - Intergenic
1189732334 X:44034270-44034292 AGTTTCACAGAGAGGGGACATGG + Intergenic
1190322950 X:49189011-49189033 GGGTAAACAGAGAGGGGCCAAGG + Exonic
1190524031 X:51310622-51310644 AGGCAGCTAGGGAGGGGACAGGG + Intergenic
1190740187 X:53283454-53283476 AGGTAGACAAAGTGTGCACATGG + Intronic
1190877659 X:54471103-54471125 AGGTAGACACAAAGGGGCTAAGG + Intronic
1190935283 X:54994105-54994127 AGGTGGACAGGGCTGGGACAGGG + Intronic
1190936321 X:55001664-55001686 AGGGAGGCAGATAGGGGAAAAGG + Intronic
1191882648 X:65857989-65858011 AGGAAGACAGAGAGGGAGGAAGG - Intergenic
1192324667 X:70122446-70122468 AGGGAGACAGAGACGGGAGGGGG - Intergenic
1193332675 X:80253011-80253033 ACGTAGACAGAGAGTGAAAACGG + Intergenic
1195001648 X:100648569-100648591 AGATAGGCAAAGAGGGGAAATGG + Intronic
1195007903 X:100704769-100704791 AGGTAGACAGAGAGTGAAAAAGG + Intronic
1195323980 X:103743250-103743272 AATTAGACAGAGAGAAGACAAGG - Intergenic
1195705381 X:107734512-107734534 AGGGAGACAGACAGGTGGCAGGG - Intronic
1196099668 X:111834452-111834474 AGAGAGACAGAGAGGGGAGGGGG - Intronic
1196142547 X:112280317-112280339 AGGAAGAAAGAGAGGGGGAAAGG + Intergenic
1197520179 X:127487806-127487828 AGGAAGACAGAGAGGAAAGAAGG - Intergenic
1197721123 X:129745384-129745406 AGGGAGACAGAGAGAGTAGAAGG - Intronic
1197771893 X:130094609-130094631 ACATAGAGTGAGAGGGGACAGGG - Intronic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198107114 X:133472538-133472560 ATGTAGAGAGAGAGTGGACTTGG + Intergenic
1198229199 X:134673374-134673396 AGGGAGAGAGAGGGGAGACAGGG + Intronic
1199474507 X:148230964-148230986 AGGAAGGGAGAGAGGGGAGAAGG - Intergenic
1199850835 X:151724070-151724092 AGAGAGACAGAGAAGAGACAGGG + Intergenic
1199971820 X:152867108-152867130 AGGAAGAGAGAGAGGAGAAAAGG - Intronic
1199982837 X:152930215-152930237 AGGGGGACAGAGAGGGGTGATGG + Intronic
1200037894 X:153345242-153345264 GGGTGGACAGAGAGAAGACAGGG + Intronic
1200354848 X:155537724-155537746 TGGCACAGAGAGAGGGGACAAGG - Intronic
1200729735 Y:6721394-6721416 AGGTGGAAAGAGAGAGGAGAGGG - Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201585516 Y:15556149-15556171 AGGTAAACAAAGAGGGGAAAAGG + Intergenic
1201858493 Y:18570723-18570745 AGATAGACAGAGAGGCAAGAGGG - Intronic
1201874828 Y:18749658-18749680 AGATAGACAGAGAGGCAAGAGGG + Intronic