ID: 1016602542

View in Genome Browser
Species Human (GRCh38)
Location 6:145878814-145878836
Sequence CTGGCTGCCAAGAAAAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016602542_1016602546 13 Left 1016602542 6:145878814-145878836 CCATCATTTTTCTTGGCAGCCAG 0: 1
1: 0
2: 2
3: 25
4: 264
Right 1016602546 6:145878850-145878872 CAAAAGAAACAACCAGCATTAGG 0: 1
1: 0
2: 5
3: 36
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016602542 Original CRISPR CTGGCTGCCAAGAAAAATGA TGG (reversed) Intronic
902718941 1:18291517-18291539 GAGGCTGCGAAGAAAAATGTGGG - Intronic
903212835 1:21828373-21828395 CTGGCTGCCTAGGAAACTGTAGG + Exonic
904854770 1:33489429-33489451 CAGGCTCCCAGGAAAGATGATGG - Intronic
905430354 1:37918039-37918061 CTGGCTGATAGGAAGAATGATGG - Intronic
906927938 1:50138911-50138933 GTGGCTGCAAAGCAATATGAAGG + Intronic
909138705 1:71835091-71835113 CTGGCTGCCAGCTACAATGATGG + Intronic
909289373 1:73863185-73863207 GGGGTTGCAAAGAAAAATGAAGG - Intergenic
909306189 1:74080930-74080952 CTGGCTAACAAGAAAAACCATGG + Intronic
909320826 1:74283584-74283606 CTTGCTGCCCTGGAAAATGATGG + Intronic
909801756 1:79818821-79818843 CTGGCTGACCAGGAAAAAGAGGG + Intergenic
910065983 1:83151359-83151381 CTGCCTGCCAAGAAAGAGAAGGG - Intergenic
915597023 1:156901765-156901787 CTGGCTGCCAACCACACTGAGGG + Intronic
919020982 1:192105448-192105470 CTGGTTGTCTAGAAAAAGGAAGG - Intergenic
919088663 1:192951404-192951426 CTGGCTGACTAGAAATATTAGGG - Intergenic
919360972 1:196594124-196594146 CTGGCTGTCAAGCAGATTGATGG + Intronic
920518214 1:206602350-206602372 GTGGCTGCCAAGGAAAGTGCTGG + Exonic
921229569 1:213055192-213055214 CTGACTGCAAAGGAACATGAGGG - Intronic
924020689 1:239778515-239778537 TTGTCTGCCAAGATAAATGTTGG - Intronic
924429703 1:243986447-243986469 ATGGCTCCCAAGAAAAGAGAAGG + Intergenic
1064830712 10:19462882-19462904 CTGGCTGGCAAGAAAAAATAAGG + Intronic
1066312251 10:34208748-34208770 CTGGCTGCCTAGGAATCTGATGG - Intronic
1068207473 10:53874419-53874441 ATGGCTGCAAACTAAAATGAGGG - Intronic
1068354236 10:55890263-55890285 CTGACAGCCAACAAAACTGAGGG - Intergenic
1069567169 10:69471405-69471427 CTGGCTGCCAAGAAAGCAGCTGG - Intronic
1071320310 10:84448714-84448736 CTGACTGCAAAGGGAAATGAAGG - Intronic
1071444114 10:85730149-85730171 CTGCCTGTCAAGGAAAATGAGGG - Intronic
1071491413 10:86139117-86139139 CAGGCCACCACGAAAAATGAGGG + Intronic
1071868802 10:89768807-89768829 CTGGCCACTAAGAAAAAAGAAGG + Exonic
1073893333 10:108124756-108124778 CTGCCTGCCAGGAAAAATGATGG + Intergenic
1075065498 10:119286630-119286652 GTGGCTGGCAGGAATAATGAAGG + Intronic
1075302896 10:121341274-121341296 CTGGTTACCCAGAAAATTGAAGG + Intergenic
1075644227 10:124087012-124087034 TTGGCTGACAAGAAACGTGAAGG + Intronic
1075775540 10:124983545-124983567 TTGGTTGCCATGGAAAATGATGG + Exonic
1075923959 10:126235757-126235779 TTGGTTTCCAAGAAAAATAATGG + Intronic
1076737059 10:132463648-132463670 CTGCCTGCTCATAAAAATGATGG - Intergenic
1079114293 11:17631169-17631191 CTGACTGCCCAGGAAAAAGAAGG + Intronic
1079325316 11:19486219-19486241 CTGGCTGCCCGGAAACAGGAAGG + Intronic
1079898794 11:26154966-26154988 CTGGCACCCAGGAAAAATAAGGG + Intergenic
1085024349 11:73228002-73228024 CTACCTGCCCAGAAAAATGCTGG + Exonic
1085113210 11:73907252-73907274 CTGCCTGCCAAAAAAGATGATGG - Intronic
1086917113 11:92543523-92543545 TTGGCTGCCATCAAAAATAAAGG - Intronic
1087448663 11:98288808-98288830 TTAACTGCCAAGAAAAATGAAGG - Intergenic
1088522940 11:110718705-110718727 ATGGCTGCAAATAAAAATGAAGG - Intergenic
1089412998 11:118262832-118262854 CTTGCTGCTAAGAAAAATACTGG + Intronic
1089653041 11:119927304-119927326 CTGACTGCCACGAGAAATTAGGG - Intergenic
1089737351 11:120558994-120559016 CTTGCTGCCAGGGAAGATGACGG - Intronic
1090539448 11:127684605-127684627 GTGGCTGCGGTGAAAAATGAAGG + Intergenic
1091389863 12:119507-119529 CTGGCTACCAAGAGAAAGAAAGG + Intronic
1092113132 12:5978787-5978809 CTGGGTGCCAAGAATATTTATGG - Intronic
1095906446 12:47383027-47383049 GTGTTTGCCTAGAAAAATGATGG + Intergenic
1096080957 12:48832123-48832145 CTGGTTGACAAAAATAATGATGG + Exonic
1096752743 12:53772492-53772514 TTGGTTACCAAGAAAAATGGAGG + Intergenic
1097246181 12:57609054-57609076 CTGGGAGCAAAGAGAAATGAGGG - Intronic
1097430313 12:59497594-59497616 ATGGATGCCAAGAAAAGAGAAGG - Intergenic
1098842888 12:75497938-75497960 ATAACTGCCAAGAAAAGTGAGGG + Exonic
1099339613 12:81411578-81411600 CTGGTAGAAAAGAAAAATGAAGG - Intronic
1100018247 12:90038328-90038350 TTGGCTTCCATGCAAAATGAAGG + Intergenic
1103939692 12:124495053-124495075 CTGGCTCCCAGGAGAAAGGAAGG + Intronic
1104270340 12:127277809-127277831 CTGGCTGGAAAGAAAAGTCAGGG + Intergenic
1106897728 13:34322940-34322962 CTGTCTGCCTATGAAAATGAGGG - Intergenic
1107598747 13:41991115-41991137 CTGGCTCCCAAGTAATTTGAGGG - Intergenic
1107966407 13:45602172-45602194 CTGGGTCCCAGGAGAAATGATGG + Intronic
1109761904 13:66841759-66841781 ATGGCTGCTATGAAAAATGGAGG + Intronic
1111500151 13:89108176-89108198 GTGGGAGCCAAGAAAAATGATGG - Intergenic
1111901786 13:94208425-94208447 CTGGCTGCCAAGATTAGTTATGG + Intronic
1112788363 13:102976610-102976632 CTGGCTGCCAAGGAAAGGGCTGG - Intergenic
1117164453 14:53019700-53019722 GTGGTTGGTAAGAAAAATGAGGG - Intergenic
1118759098 14:68867938-68867960 CTTGCTGCAAAGAAAAATTCTGG - Intergenic
1119440026 14:74621938-74621960 CTGGCTGACAAGAAGAAACAGGG + Intergenic
1119885587 14:78138137-78138159 GTTTCTGACAAGAAAAATGAGGG - Intergenic
1120515722 14:85467669-85467691 CTGGCTTTCAAGATGAATGAGGG - Intergenic
1120616314 14:86709558-86709580 CTTGCTCCCAAGAGAAATCAAGG + Intergenic
1122293512 14:100692501-100692523 CTGGCTGCCAACATAAATTCAGG - Intergenic
1127431660 15:58916063-58916085 CTGGCTGGCCAGAAAAATTATGG - Intronic
1128486444 15:68095335-68095357 CTGGCTGCCATGCAAACTCATGG - Intronic
1130695008 15:86122435-86122457 CTGGCTTCCAAGAAACAGTATGG + Intergenic
1132918015 16:2364662-2364684 TTGGCTGTCAAAAAAAAGGAAGG + Intergenic
1134273068 16:12751237-12751259 CTTGCTGCCAACAAAAAGAAGGG - Intronic
1134446686 16:14336512-14336534 AGGGCTGCCAAGGAAATTGATGG - Intergenic
1135862606 16:26070582-26070604 TTGGCAACCAAGCAAAATGATGG + Intronic
1137338840 16:47578528-47578550 CTGGATGTCAACAAAAATAATGG - Intronic
1138410583 16:56836582-56836604 CAGGCTGACAAGACAAATTATGG - Exonic
1138487715 16:57357556-57357578 GGGAATGCCAAGAAAAATGAAGG + Intergenic
1138733149 16:59218538-59218560 CTGTCACCTAAGAAAAATGATGG + Intergenic
1139135238 16:64195800-64195822 CTGGGTGCCAAGAAAATGGTGGG - Intergenic
1139452323 16:67040209-67040231 CTGGAAGCAAAGAAAATTGAAGG + Intronic
1140435406 16:74942823-74942845 CCCGCTGCAAAGAAAAATCAGGG + Exonic
1141380825 16:83575134-83575156 CCGGCAGCCATGGAAAATGAAGG + Intronic
1143545718 17:7593972-7593994 TCGGGTGCCAACAAAAATGAAGG + Exonic
1144261743 17:13528253-13528275 CTGGCAGGCAACAAAAAGGATGG + Intronic
1147538972 17:41340714-41340736 CTGGCTGCTGTGAAACATGAGGG - Intergenic
1148868732 17:50643089-50643111 CTGGCTGCCAGGGAAAAGCAAGG + Intronic
1148966266 17:51438540-51438562 CTGACTTCCAATAAACATGAAGG + Intergenic
1149439630 17:56663670-56663692 CTGGATGCCCAGGAGAATGACGG + Intergenic
1149886535 17:60345679-60345701 CTGGCTCCTAAGAAAAATTGAGG + Intronic
1151932956 17:77244363-77244385 CTGTCTCCAAAAAAAAATGAAGG + Intergenic
1152478194 17:80532239-80532261 ATGGCTGCCCAGAAATATAAAGG - Intergenic
1154107785 18:11538011-11538033 TTGGCTTCAAAAAAAAATGAAGG + Intergenic
1155694944 18:28674279-28674301 CTGGCAGCTAAGAAAAAAAAGGG - Intergenic
1157165568 18:45355601-45355623 CTGGCAGCTAAAAAAAATCAGGG - Intronic
1158036998 18:53043923-53043945 GTGAATGCCAAGAAAAAAGAAGG + Intronic
1158877661 18:61748702-61748724 CTGGCTGACAAGGAAAACGGTGG - Intergenic
1159275467 18:66215018-66215040 CTGGCTGCCAAAATGAATGGGGG - Intergenic
1159899898 18:74036342-74036364 CTGGCTGTCAAGCAGAAGGAAGG - Intergenic
1162966654 19:14159400-14159422 CTGGCTGCCAAGGAGAACGTGGG - Exonic
1163231339 19:16005198-16005220 CTGCCTGCCAGGGAAAATGATGG - Intergenic
1163610550 19:18299163-18299185 CTGGCTGGCGAGCAAAGTGAGGG - Intergenic
1163693218 19:18749022-18749044 TTGGCTGCCAGGCAAAATGTGGG - Intronic
1164295323 19:23904701-23904723 CTTGCTGCCAATAAATATGTGGG + Intergenic
1164367200 19:27598513-27598535 CTGGCTACAAAACAAAATGAAGG + Intergenic
1165274554 19:34736863-34736885 CAGGCTGCCCAGACAACTGAAGG + Intronic
1165412507 19:35670588-35670610 CTGCCTGTCTAGAAAAATGAAGG - Intronic
1167532798 19:50028794-50028816 CTGTCTGCCAACAAACATTATGG + Intronic
1168557656 19:57356573-57356595 CTGGCTGTCAAGAAGAGTAAAGG - Exonic
925214919 2:2086042-2086064 CTGATTTCGAAGAAAAATGAAGG + Intronic
925426108 2:3750060-3750082 CTGGGTGCCGAGCAGAATGATGG - Intronic
928387061 2:30879733-30879755 CTGGGTGCAAAGAAACATGGTGG - Intergenic
928455893 2:31421319-31421341 CTGGTTGAAAAGAAAAAGGACGG - Intergenic
928531389 2:32196012-32196034 CTGGCTTTAAAAAAAAATGAAGG + Intronic
929978346 2:46656256-46656278 CTGCCTGGCAGGAAAAAGGAAGG - Intergenic
932252508 2:70257355-70257377 CTAACTGTAAAGAAAAATGAGGG - Intergenic
933522852 2:83394621-83394643 GCGGCTGCCAACAAAACTGAAGG + Intergenic
933997653 2:87681532-87681554 CCAGCTGCCAAGAGAGATGAAGG + Intergenic
935863798 2:107363228-107363250 CTGACTGCCAAGCCAAATAAGGG - Intergenic
936296199 2:111269338-111269360 CCAGCTGCCAAGAGAGATGAAGG - Intergenic
940261894 2:151789751-151789773 CTTGCTGCCTGGAAGAATGACGG - Intronic
940591372 2:155732128-155732150 CTGGATCTCAAGAAAAAGGAAGG + Intergenic
940676310 2:156727873-156727895 CCAGCTGCCAAGGAGAATGAAGG - Intergenic
941770829 2:169343798-169343820 CTGGCTGCCAAGCAAAATTCTGG - Intronic
942521447 2:176808689-176808711 CTGGCTGCCAACAATAGTGGGGG - Intergenic
942595910 2:177591715-177591737 GTGGGTTCCAAGAAGAATGATGG + Intergenic
942981521 2:182089026-182089048 CTGGCTGTCTAGATAAAAGAAGG - Intronic
944007284 2:194925043-194925065 CTGGCTACAAAGAAAAGGGAGGG + Intergenic
944314783 2:198272761-198272783 CTGGCAGCAAAGAACAATGCAGG - Intronic
944419957 2:199519111-199519133 CTGTCTGCCAAGAAAAACCAAGG - Intergenic
944976430 2:205058070-205058092 GTGGTTGCCAAGGAAAAGGAGGG - Intronic
946132860 2:217621276-217621298 CAAGTTGCCAAGAAAAATGCAGG - Intronic
946967232 2:225049680-225049702 CTGGATGACAAAAAAAATGAAGG - Intergenic
948460428 2:238127603-238127625 ATGGCTGCCAAGAAGAAGAAGGG - Exonic
1169410976 20:5370106-5370128 CTTGCTTCCAGGAAGAATGAGGG - Intergenic
1169492020 20:6079023-6079045 CTGGCTGCCAAGAAACCCGATGG - Intronic
1170459469 20:16563959-16563981 CTGGCTGGAAAGAGAAAGGAGGG - Intronic
1170826483 20:19800555-19800577 CTGGCTTCCCAGAAACATGGTGG - Intergenic
1172571195 20:35972185-35972207 CTGGCTGTCAAGATGAAGGAAGG - Intronic
1173681819 20:44887190-44887212 CAGGGATCCAAGAAAAATGAGGG - Intronic
1175277996 20:57784915-57784937 CTGGCTGCCAAGCAAGAAGATGG + Intergenic
1176288124 21:5029663-5029685 CTGGCTGCCATGAACATTCACGG - Intronic
1177492771 21:21848789-21848811 CAGGCTGCCAAGAACTATGGTGG + Intergenic
1178394516 21:32230428-32230450 CTGGCTCCCAGGACAAATAAGGG + Intergenic
1178570783 21:33735048-33735070 CTAGCTGACATGAATAATGATGG + Exonic
1179044880 21:37835056-37835078 CTGGCTGCCAAGGAAAAGTGGGG + Intronic
1179869057 21:44233812-44233834 CTGGCTGCCATGAACATTCACGG + Intronic
1179941725 21:44643915-44643937 CTGGCTGCCCAGCACAATGCTGG - Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182811923 22:33123977-33123999 CTGCCTGCCAGGATAAATGACGG + Intergenic
1184846848 22:47093224-47093246 CTGGCCGCCAAGACACATCAGGG - Intronic
949902528 3:8829318-8829340 ATGGCTGCAGAGAATAATGAGGG + Intronic
950036073 3:9886698-9886720 CAGGCTGCCAAGGAAATTCATGG + Intergenic
950778121 3:15367891-15367913 CAGGCTGCCGTGAAAACTGAAGG + Intergenic
952447925 3:33401300-33401322 AGGGATGCCAAGGAAAATGAAGG + Intronic
953775593 3:45814158-45814180 CTGGCTGCAAAGGGACATGAAGG + Intergenic
955051667 3:55416594-55416616 CTTGCCTCCAAAAAAAATGAGGG + Intergenic
955493131 3:59503066-59503088 CTCGCAGTCAAGAAAGATGAAGG - Intergenic
956331687 3:68117199-68117221 CTGGCTCCAAGGGAAAATGAAGG - Intronic
956987238 3:74715441-74715463 ATGACTGCAAAGAGAAATGAAGG - Intergenic
959400214 3:105891657-105891679 CTGGATTCTAAGAAAAATCAGGG - Intergenic
959503437 3:107132697-107132719 CTGGCTACCACGAAACATGTGGG + Intergenic
960728478 3:120696868-120696890 GTGGCAGCTGAGAAAAATGAGGG + Intronic
962145192 3:132833256-132833278 TTGGGGGCAAAGAAAAATGAAGG + Intergenic
962286499 3:134090658-134090680 CTGGCTGCAAAGGAATCTGAGGG + Intronic
962896807 3:139722939-139722961 CTAGATGCCAAGAGAAATGATGG + Intergenic
964303563 3:155316535-155316557 CAGGCTTCCAAGAAAGATTATGG + Intergenic
965483494 3:169249218-169249240 ATGGCTACCAAGTCAAATGAAGG + Intronic
966104065 3:176313827-176313849 AGGGCTGCCATAAAAAATGAAGG + Intergenic
966564025 3:181355956-181355978 CTGGCTGAAAACAAAAATAAAGG - Intergenic
967895311 3:194390970-194390992 ATGGCTGCCAAGAAAAAGAGAGG + Intergenic
968280067 3:197469960-197469982 CTGTTTGTGAAGAAAAATGATGG + Intergenic
969557723 4:7924624-7924646 TTTACTGACAAGAAAAATGAGGG + Intronic
970874007 4:20848591-20848613 CTGGCTCCAAAGATTAATGATGG + Intronic
971242796 4:24903713-24903735 TTGGCTGCAGAGAAACATGAGGG - Intronic
972068488 4:34983191-34983213 CTGGCTTTAAAGAAATATGAGGG + Intergenic
974367844 4:60975289-60975311 CTGGGTACATAGAAAAATGAAGG - Intergenic
975660340 4:76682202-76682224 CTGACTGGGAAGAAAGATGAAGG + Intronic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
976261386 4:83148316-83148338 CTGGCTTACCAGAAAAATGAGGG - Intergenic
977048485 4:92096412-92096434 CTGGCTGCCAAAAAAGCTGTAGG + Intergenic
977384897 4:96326364-96326386 CAGGCTGCCATGCAAACTGATGG + Intergenic
977755458 4:100666500-100666522 CTGGCTGCCATGTAGAAGGATGG - Intronic
981309784 4:143286112-143286134 CTGGCTGTCAAAAGAAATGCAGG - Intergenic
981667886 4:147250563-147250585 CTGGATTCCAAGAAATATGTTGG - Intergenic
981734612 4:147936174-147936196 CTGGCTTCCAAAAAGAAGGAAGG + Intronic
982402717 4:154985846-154985868 CTGCATACCAAGAAAACTGATGG - Intergenic
982717529 4:158824635-158824657 CTGGCTGTTAAGGAAAATGGGGG - Intronic
982729581 4:158941809-158941831 CTGGTTCCAAAGAAAAATCAAGG + Intronic
985152137 4:186958507-186958529 CTGACTGCCAACAAATATGTAGG + Intergenic
985389325 4:189478659-189478681 CAGGCTGCCTGGAAAAAAGAGGG + Intergenic
985700549 5:1369418-1369440 CTGCCTACCAGGAAAGATGACGG - Intergenic
988456683 5:31393113-31393135 CTGGCTGGGGAGACAAATGATGG - Intergenic
988661007 5:33268530-33268552 AGGGCTGCCAAGAGAAATGGTGG + Intergenic
988829208 5:34971133-34971155 ATGGTGGCCAAGAGAAATGAGGG + Intergenic
990205988 5:53430192-53430214 CTAGCCTCCAAGGAAAATGAGGG - Intergenic
994900122 5:105760540-105760562 CTGCCTACTAGGAAAAATGATGG - Intergenic
995341793 5:111069383-111069405 CTGGAAGCCTAGGAAAATGAAGG + Intergenic
995618630 5:113997438-113997460 CTGGCTGCTTAGAAAAAAGAAGG + Intergenic
997136235 5:131329352-131329374 CTGGATTCCAAGAACAATAATGG - Intronic
997388161 5:133490154-133490176 CAGGGTGCCATGAAAAATGCCGG + Intronic
998933525 5:147208199-147208221 CTGGGGGCAAAGAGAAATGATGG - Intergenic
1001880209 5:175236951-175236973 ATGGCTTCCAAGAGAAATCAGGG - Intergenic
1004744855 6:18499590-18499612 CTGGATGCCTGGAAAAATTAGGG + Intergenic
1005271886 6:24174685-24174707 ATGGATCGCAAGAAAAATGAAGG - Exonic
1005801819 6:29432904-29432926 CCTGCTGCCAAGAAAAAATAGGG - Intronic
1006873707 6:37277003-37277025 CTGACTTCTGAGAAAAATGAAGG - Intronic
1006980413 6:38143109-38143131 CTGGCTGTCAGGTAAAGTGAGGG + Intronic
1007167484 6:39839131-39839153 CTGGCTGCAAAGTAGAATCACGG - Intronic
1008148514 6:47921708-47921730 CTGGCTGCCAAGAATCACAATGG + Intronic
1008856703 6:56096777-56096799 GTGGCAGCCAAGAAAATTAATGG - Intronic
1010059182 6:71602775-71602797 GTGTCTGTCAATAAAAATGAGGG - Intergenic
1010700239 6:79036003-79036025 CAGGATGCCAAGAAACATTACGG + Intronic
1010777276 6:79901674-79901696 GGGGATGCCAAGAAAAATGCAGG + Intergenic
1011173629 6:84535344-84535366 CAGGGTGGCAAGAAAAGTGAGGG - Intergenic
1011507741 6:88067027-88067049 CTGTATACCAAGAACAATGAAGG - Intergenic
1014199350 6:118591067-118591089 CAGGCTGAGAAGCAAAATGATGG + Intronic
1015310276 6:131759582-131759604 CTGGCTACCAAGAAAAAAAAGGG - Intergenic
1016602542 6:145878814-145878836 CTGGCTGCCAAGAAAAATGATGG - Intronic
1017292183 6:152751385-152751407 CTTGCTGCCTATAAAAATTATGG - Intronic
1017683911 6:156892668-156892690 CTGGCTGGAAAGAGACATGAAGG - Intronic
1017871828 6:158493478-158493500 CTGGCTGTCCAGAAAAAGAAAGG + Intronic
1018341219 6:162852887-162852909 TTGGCTTTCAAGAAAATTGAAGG - Intronic
1018498961 6:164381976-164381998 CTGGCTTCCATGATAAAAGAAGG + Intergenic
1019328741 7:452489-452511 CTGGCTGCCAAGAGTGAGGATGG - Intergenic
1027278126 7:76583416-76583438 CTGCCTGCCAAGAAAGAGAAGGG + Intergenic
1027853307 7:83476700-83476722 CTGACTGCCAAAACAAATGAAGG - Intronic
1028484083 7:91339468-91339490 CTAGCTGCCCAAGAAAATGAAGG - Intergenic
1028490567 7:91406874-91406896 CTGGCTGAGAAGAAAGATGCTGG - Intergenic
1031147042 7:118008079-118008101 CTGTCTGCAAACCAAAATGAGGG - Intergenic
1032205254 7:129858656-129858678 CTGGGTAACAAGAAAAATGAAGG + Intronic
1032495328 7:132357180-132357202 GTGGCTGCCATGAAAAAGGTTGG - Intronic
1032725688 7:134588360-134588382 CTGGCTGTCAATAAATATGTGGG - Intergenic
1033017259 7:137684562-137684584 CTGGCTGCCGAGGGAAATCATGG - Intronic
1033181105 7:139179433-139179455 CAGGCTGCTAAGAAAAGTGAGGG - Intronic
1033304443 7:140214208-140214230 CTGGCTGCCAAGTCAATGGAGGG + Intergenic
1033873717 7:145788597-145788619 CAGGGAGCCAAGAAAGATGAAGG - Intergenic
1033977704 7:147122806-147122828 CTGGGTGCCAAGGAACATGAAGG - Intronic
1034203715 7:149298260-149298282 CCTGGTGCCAAGAGAAATGATGG - Intergenic
1034702649 7:153109717-153109739 CTGGATGCCAAGAACAACCATGG - Intergenic
1035088335 7:156280837-156280859 ATGGGTGCAAAGAAAAGTGATGG - Intergenic
1040621031 8:49092974-49092996 CAGGCTTCCAAGAAAATAGATGG - Intergenic
1041044490 8:53878112-53878134 GTGGTTGCCAAAAAAAATGAAGG - Intronic
1042935687 8:74055736-74055758 CTGGCTGGCAGCAAAAGTGATGG + Intergenic
1044359304 8:91262511-91262533 CTGGCTGACAAGAGAAGTAAGGG + Intronic
1045827232 8:106412686-106412708 CTCGCAGCCAATAAAAATTAAGG - Intronic
1046326274 8:112651515-112651537 CTGGGTGCTTAGAAAAATAATGG - Intronic
1046806884 8:118488508-118488530 TTGGGTGCCAAGAAACATGAGGG - Intronic
1047773398 8:128049119-128049141 CTGGCGGCCAGGAAAAAGAAAGG - Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1049083450 8:140459594-140459616 CTGGCTGAAAGGAAAAATGCTGG - Intergenic
1049602651 8:143515092-143515114 CTGGGTTCCGAGAAACATGAGGG + Intronic
1050718797 9:8561429-8561451 CCTGCGTCCAAGAAAAATGAGGG - Intronic
1051887297 9:21906876-21906898 CTTTTTGCCAAGAAAAAAGATGG + Intronic
1053125203 9:35575583-35575605 CCGCCTGCCAGGGAAAATGATGG - Intergenic
1053569728 9:39291796-39291818 CAGGCTGAAAAGAAAAGTGAAGG + Intergenic
1053835688 9:42132828-42132850 CAGGCTGTAAAGAAAAGTGAAGG + Intergenic
1054091358 9:60850801-60850823 CAGGCTGTAAAGAAAAGTGAAGG + Intergenic
1054112773 9:61126371-61126393 CAGGCTGTAAAGAAAAGTGAAGG + Intergenic
1054127420 9:61327217-61327239 CAGGCTGAAAAGAAAAGTGAAGG - Intergenic
1054594941 9:67055777-67055799 CAGGCTGTAAAGAAAAGTGAAGG - Intergenic
1055510985 9:76995359-76995381 CTTTTTGACAAGAAAAATGAGGG + Intergenic
1055840502 9:80497396-80497418 CTGACAGCCAGGAAAATTGATGG - Intergenic
1056112359 9:83408474-83408496 CTGGGTGCCAAGAAATGGGAGGG - Intronic
1056831357 9:89919666-89919688 CTGGCTGCCTAGGAAAACCACGG - Intergenic
1057956677 9:99414763-99414785 CTGGCAGCCTTGAGAAATGAGGG - Intergenic
1058226256 9:102368226-102368248 CTTGCTGCCAATAAATATGTGGG + Intergenic
1059356107 9:113700705-113700727 CTGTGTGCCAAGAAGAAAGATGG + Intergenic
1060516939 9:124271810-124271832 CTCCCTGCCAAGAACAAGGATGG - Intronic
1187301854 X:18058710-18058732 CTGACTTCCAAGATAAGTGATGG + Intergenic
1191661501 X:63656264-63656286 CAGTCTGCCAAGAGAAATGGAGG + Intronic
1192719713 X:73679795-73679817 CTGGCTGAGGAGAAAAAAGAAGG - Intronic
1193325167 X:80172035-80172057 CTGCCTGCCAAGGAAAATGATGG - Intergenic
1193787254 X:85774431-85774453 CTTGCTGTCAAGAAATATGTGGG - Intergenic
1194555235 X:95350180-95350202 TTGACTGCCAAGAAAAACTACGG + Intergenic
1194996184 X:100593727-100593749 AAGGCTGCCAAGAAAACTGTTGG + Intronic
1195769848 X:108339035-108339057 CTCCCTGCCAAAAAAAATGTTGG + Intronic
1196812893 X:119642797-119642819 CTGGCGGCCAAGCAATTTGAGGG - Intronic
1197186363 X:123591848-123591870 CTGTCTGCCAACAGAACTGAAGG + Intergenic
1198766361 X:140083532-140083554 TTGACTACTAAGAAAAATGAAGG + Intergenic
1199099299 X:143780545-143780567 CTGGATGGCAAGAAAACTCATGG - Intergenic
1201751481 Y:17436554-17436576 CTGGCATCCAGGAAAAATCAGGG + Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic
1202170230 Y:22035607-22035629 CTTGCTGTCAAGAAATATGTGGG + Intergenic
1202221136 Y:22550766-22550788 CTTGCTGTCAAGAAATATGTGGG - Intergenic
1202321977 Y:23644896-23644918 CTTGCTGTCAAGAAATATGTGGG + Intergenic
1202548790 Y:26025160-26025182 CTTGCTGTCAAGAAATATGTGGG - Intergenic