ID: 1016604726

View in Genome Browser
Species Human (GRCh38)
Location 6:145907295-145907317
Sequence CGGTAGAAATGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 1, 2: 3, 3: 52, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016604726 Original CRISPR CGGTAGAAATGGAGAGAAGT GGG (reversed) Intronic
900487457 1:2930102-2930124 TGGTGGAAAAGGAGAGAAGCCGG + Intergenic
902261180 1:15226067-15226089 GGGTAGCACTGGAGAAAAGTAGG + Intergenic
902340670 1:15781626-15781648 AAGTAGAAATGGTGAGATGTGGG - Intronic
902652720 1:17846999-17847021 CGGGAGAGGTGGTGAGAAGTGGG - Intergenic
902960477 1:19959705-19959727 GGGTAGAAAGGGAGGGAAGGAGG - Intergenic
903311715 1:22463860-22463882 CATTAGAAATGGAGAGAATCTGG + Intronic
904149884 1:28429485-28429507 CGGAAGAAATGTAGAGATGATGG + Intronic
904236259 1:29119333-29119355 AGGTAGAAATGGTGAGGAGGGGG + Exonic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906484764 1:46225814-46225836 CAGTAGAATTAGAGAGATGTAGG - Intergenic
907060713 1:51421098-51421120 CGTTAGAAATAGAGAAAACTGGG - Intronic
907672745 1:56491267-56491289 GGGGGGAAATGAAGAGAAGTTGG - Intergenic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
908120640 1:60983179-60983201 AGGGAGAAATGGGGAGGAGTGGG + Intronic
908121643 1:60991525-60991547 TGGTAGAGCTGGTGAGAAGTAGG - Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
908907449 1:69032417-69032439 AGGAAGAAATGAAGAGAGGTTGG + Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909405020 1:75279178-75279200 AGGGAGAGATGAAGAGAAGTTGG - Intronic
909761908 1:79299425-79299447 TGGAAGAAATGGAGAGATGTTGG - Intergenic
909767107 1:79369966-79369988 GGGTAAGAATGGAGAGGAGTTGG + Intergenic
910064134 1:83132652-83132674 TGGTGGAAATGGATAAAAGTGGG - Intergenic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910576410 1:88769811-88769833 AAGAAGAAATGGGGAGAAGTTGG + Intronic
910606944 1:89097140-89097162 TGGGAGAAATGGAGAGATGATGG + Intergenic
910822382 1:91365210-91365232 GGGAAGAAATGGGGAGATGTAGG + Intronic
911054120 1:93696377-93696399 GGGTAGAAATGGAGAGAGACTGG - Intronic
911114574 1:94233385-94233407 TGGTAGCAGTAGAGAGAAGTGGG - Intronic
912281490 1:108319712-108319734 AGGGAGAAATGGGGAGATGTTGG - Intergenic
912498632 1:110107292-110107314 AGGTAGAAAAGGAAAGAACTGGG - Intergenic
912718174 1:111997133-111997155 AGGAGGAAATGGAGAGAAATGGG - Intergenic
913461806 1:119094822-119094844 AGGAGGAAATGGAGAGATGTAGG - Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913967118 1:143385488-143385510 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
914061494 1:144211095-144211117 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
914117656 1:144755274-144755296 TGGCAGAAAGGGAGAGAACTGGG - Intergenic
915688050 1:157656167-157656189 CAGCAGAAAAGGAGAGAAATTGG + Intergenic
916013465 1:160727344-160727366 AGGGAGAAAGGAAGAGAAGTGGG - Intergenic
916875946 1:168969142-168969164 AGGAAGAAATGGGGAGATGTAGG + Intergenic
916900390 1:169215949-169215971 TGGAAGAAATGGAGAGATGATGG + Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
919102060 1:193107292-193107314 AGGTGGAAATGGGGAGATGTTGG + Intergenic
919318969 1:196009641-196009663 TGGGGGAAATGGAGAGAGGTTGG + Intergenic
919367100 1:196675366-196675388 CGATAGAGATGGAGAGATGGAGG + Intronic
919496329 1:198274126-198274148 TGGAAGAAATGGAGAGCAGCTGG + Intronic
921384549 1:214555338-214555360 TTGGAGTAATGGAGAGAAGTGGG + Intergenic
922084101 1:222329044-222329066 TGGGAGAAATGGGGAGATGTAGG + Intergenic
922201788 1:223409229-223409251 GGGTGGAAATGGAGGAAAGTGGG + Intergenic
922429748 1:225539214-225539236 CAGTAGCAATGGAGAGAGTTTGG - Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923806470 1:237263434-237263456 CCATAGAAATGGACAGAATTGGG + Intronic
923964515 1:239122390-239122412 TGGTAGGAATGAAGAGAAGCTGG + Intergenic
924349972 1:243105378-243105400 TGAGAGAAATGGAGAGAGGTTGG + Intergenic
1063919699 10:10920685-10920707 AGGGAGAAATGGAGAAAAGAAGG + Intergenic
1063954767 10:11255735-11255757 TCCTAGAAATGGAGAGAAGGTGG - Intronic
1064026057 10:11849721-11849743 CGGCAGAAGTGTAGAGAAGAGGG + Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1065624894 10:27620114-27620136 GGTTGGAAATGGAGAGAGGTAGG - Intergenic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1066748687 10:38630328-38630350 GGGTAGAACTGGGGAGATGTCGG + Intergenic
1068461049 10:57329229-57329251 TGGTAGAAGTGTAGACAAGTAGG + Intergenic
1069312624 10:67057406-67057428 TGAGAGAAATGGAGAGATGTTGG - Intronic
1069347777 10:67489711-67489733 GGGTAGAAATGGAGAAAATGAGG + Intronic
1069402390 10:68062820-68062842 AGGTTGAAAGGGAGAGAAATTGG - Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070150605 10:73802594-73802616 AGGCAGAAATGGTAAGAAGTGGG + Exonic
1070597902 10:77845581-77845603 AGGGAGAAATGGAGGGAAGGAGG + Intronic
1071508974 10:86249586-86249608 GGGTAGAAATGGAGGTGAGTCGG - Intronic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1072583556 10:96761420-96761442 GGGCAGAAATGGGGAGAAGATGG - Intergenic
1073658084 10:105439426-105439448 AGGGGGAAATGGAGAGATGTTGG - Intergenic
1073707133 10:105997621-105997643 CAGAAGAAATGAAGAGATGTTGG - Intergenic
1073823878 10:107297148-107297170 GGGAAAAAATGGTGAGAAGTAGG + Intergenic
1074052873 10:109895764-109895786 TATTAGAAATGGAGAGAAGTGGG - Intronic
1074423341 10:113328789-113328811 AGGCAAAAAGGGAGAGAAGTGGG - Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1078356318 11:10634534-10634556 TGGGAGAAATGGGGAGATGTTGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078820446 11:14875187-14875209 CGGTACATAAGGAGAGAAGTAGG - Intergenic
1079992027 11:27256270-27256292 CAGGAGAAAGAGAGAGAAGTAGG + Intergenic
1080075510 11:28142953-28142975 CAGTTTAAATGGAGAGAGGTGGG + Intronic
1080605685 11:33863032-33863054 CGGTAGAGATAGGGAGAAGCTGG + Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081244904 11:40753151-40753173 AGGGGGAAATGGAGAGAGGTTGG + Intronic
1085352363 11:75807318-75807340 CGCTAGAAAGAGAGAGACGTCGG - Intergenic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1089463901 11:118670952-118670974 GGGTATAAATGGAGAGAAAGAGG - Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089768651 11:120786621-120786643 CAGTTGAAATGAAGAGATGTTGG - Intronic
1089932999 11:122333274-122333296 AGGAAGAAAGGGAGAGAAGGAGG - Intergenic
1091257294 11:134200585-134200607 TGGTAGGAATGCAGAGAAATAGG + Intronic
1091798267 12:3309477-3309499 GGGTAGAAAAGGAGTGAGGTAGG - Intergenic
1091823151 12:3491219-3491241 CGGCAGAAGTTGAGAGGAGTTGG + Exonic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092621130 12:10270444-10270466 CGGTTCAAAAAGAGAGAAGTTGG + Intergenic
1092749456 12:11705036-11705058 CGGTGGAAATGGGGAGATGTGGG + Intronic
1092882603 12:12899390-12899412 TGGTTTAAATGGAGAGAGGTTGG + Intronic
1093327495 12:17795616-17795638 CTTTAGTAATGGAGAGAACTAGG + Intergenic
1094128710 12:27051764-27051786 GGGAAGAGATGGTGAGAAGTGGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095319613 12:40810523-40810545 TGGTGGAAATGGGGAGATGTTGG - Intronic
1096005416 12:48166470-48166492 CCATAGAAAGGGAGAGAAGGGGG + Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096571959 12:52528693-52528715 GGGTAGAGATGGAGAGCATTTGG - Intergenic
1096884926 12:54708277-54708299 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1097452018 12:59748138-59748160 TGGTAGAAGTGGAGAGGCGTGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098786734 12:74767830-74767852 TGGGAGAAATGGGGAGATGTTGG + Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099156376 12:79181528-79181550 CGGTTGATATGGAGAAGAGTGGG - Intronic
1099610314 12:84859259-84859281 AGGTGAAAATGGGGAGAAGTAGG + Intergenic
1099620246 12:84995077-84995099 GGGAAGAAATGGAGTAAAGTTGG + Intergenic
1100235104 12:92652921-92652943 GGAGAGAAATGGAGAGAAGGGGG - Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100913838 12:99395082-99395104 AGAGAGAAATGGAGAGATGTTGG - Intronic
1101239626 12:102824958-102824980 GGAGAGAACTGGAGAGAAGTGGG - Intergenic
1102443354 12:112980382-112980404 AGGAGGAAATGAAGAGAAGTTGG - Intronic
1103010602 12:117455586-117455608 TGGAAAAAATGGAGAAAAGTGGG - Exonic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103245701 12:119455249-119455271 TGGGAGCAATAGAGAGAAGTAGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1105656345 13:22443967-22443989 TGGGAGAAATGGGGAGAAGTTGG - Intergenic
1107021020 13:35751698-35751720 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
1107333079 13:39322656-39322678 AGGAAGAAAAGGAGAGAAGGAGG + Intergenic
1108982033 13:56526413-56526435 CGGGAGAATTGGAGAAATGTTGG - Intergenic
1109103362 13:58215405-58215427 AGGAAAAAATGGAGAGAAGTGGG + Intergenic
1110778373 13:79435971-79435993 GGGAAGAAATGGGGAGATGTAGG + Intergenic
1111359769 13:87160964-87160986 TGGGAGAAAGGGAGAGAAGAGGG + Intergenic
1111723782 13:91978875-91978897 CAGTAGAAATGAAGAGGACTTGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112834700 13:103500109-103500131 CAAAAGAAATGGAGAGAAATGGG + Intergenic
1114238741 14:20846646-20846668 TGGTAGAAAGGAAGGGAAGTAGG + Intergenic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114834716 14:26190193-26190215 CGTTAGGAAAGGAGAGAATTAGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115891519 14:38035019-38035041 TGATAGAATTGAAGAGAAGTAGG + Intronic
1115920736 14:38370335-38370357 AGGGAGAAATGGGGAGAAGTTGG + Intergenic
1116132536 14:40875100-40875122 TGGCAGAAATGTGGAGAAGTTGG + Intergenic
1116640669 14:47458506-47458528 AGGGGGAAATGGAGAGATGTTGG + Intronic
1117760309 14:59020017-59020039 TGGTAGAAATGGGGAGATGTTGG + Intergenic
1118151773 14:63197257-63197279 CAGTAGCCATGGACAGAAGTAGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119208822 14:72814009-72814031 CGGTAGAGATGGGGAAAGGTGGG - Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1120150631 14:81029409-81029431 AGGGAGAAAGGGAGAAAAGTGGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121971296 14:98358845-98358867 CAGTAGAAATGGAGAAAGGGTGG - Intergenic
1121991133 14:98558692-98558714 CTAGAGAAATGGAGAGAACTTGG - Intergenic
1122541807 14:102502216-102502238 AGGGAGAAAGGGAGAGAAGGGGG + Exonic
1123506697 15:20948180-20948202 CGAGAAAAATGGAGACAAGTAGG - Intergenic
1123510393 15:20992903-20992925 AGGTAGAAATGGAGAGATGATGG - Intergenic
1123563922 15:21521925-21521947 CGAGAAAAATGGAGACAAGTAGG - Intergenic
1123567608 15:21566652-21566674 AGGTAGAAATGGAGAGATGATGG - Intergenic
1123600176 15:21959209-21959231 CGAGAAAAATGGAGACAAGTAGG - Intergenic
1123603869 15:22003945-22003967 AGGTAGAAATGGAGAGATGATGG - Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1125100052 15:35902115-35902137 TGGTAGAAATGGAGATAAATGGG + Intergenic
1125110295 15:36024403-36024425 AGGAAGAAATAGAAAGAAGTGGG + Intergenic
1125457768 15:39878267-39878289 TGGGAGAAATGGGGAGATGTTGG - Intronic
1125718671 15:41834781-41834803 CGGTAGAAGTGGAGCGGAGTTGG - Exonic
1125969702 15:43901888-43901910 TGGTAGAAATGAAGAGAGGAGGG - Intronic
1126957774 15:53953416-53953438 GGGTTGAATTGGACAGAAGTTGG - Intergenic
1126995556 15:54439914-54439936 GGGGTGAAATGAAGAGAAGTTGG - Intronic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127065806 15:55236980-55237002 CGGGGGAAACGGAGAGAGGTTGG - Intronic
1127217633 15:56840962-56840984 GGGAAGAAATGGGGAGATGTAGG - Intronic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1128491361 15:68148901-68148923 CGATAGAAATGGAGGTAAGTAGG + Intronic
1128643003 15:69353692-69353714 GGGTAGAAATGGAGGGAGGTGGG + Intronic
1128757228 15:70191335-70191357 TGAAAGAAAAGGAGAGAAGTTGG - Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130711506 15:86286443-86286465 GGGGAGGAATGGAGAGATGTTGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1202972282 15_KI270727v1_random:249020-249042 CGAGAAAAATGGAGACAAGTAGG - Intergenic
1202975971 15_KI270727v1_random:293747-293769 AGGTAGAAATGGAGAGATGATGG - Intergenic
1133876047 16:9735598-9735620 TGGTAGAAATGGAATGCAGTGGG + Intergenic
1134296392 16:12949998-12950020 AGGTGGAAATGGGGAAAAGTTGG - Intronic
1136734074 16:32446972-32446994 GGGTAGAACTGGGGAGATGTTGG - Intergenic
1138317430 16:56082246-56082268 CGGTAGAAATGGAGACAGTAAGG - Intergenic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139818761 16:69701481-69701503 GGGAAGAAATGGAGAAAAGAAGG - Intronic
1203019004 16_KI270728v1_random:382623-382645 AGGTAGAACTGGGGAGATGTTGG + Intergenic
1203037339 16_KI270728v1_random:655781-655803 AGGTAGAACTGGGGAGATGTTGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142972386 17:3621583-3621605 GGGAAGGAATGGAGAGAAGGAGG - Intronic
1143217864 17:5238688-5238710 CTCCAGAAATGGGGAGAAGTGGG - Intergenic
1143702091 17:8668232-8668254 TGGGAGAAATGGAGAGAAGATGG - Intergenic
1144342561 17:14322195-14322217 TCTTAGAAATGTAGAGAAGTGGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1148443647 17:47725067-47725089 AGGCAGAAAAGGAGAGAAGGAGG + Intergenic
1148572227 17:48679155-48679177 TGGTAGAAATGGATAGACCTGGG - Intergenic
1148760929 17:49999636-49999658 GGGTAGAAGTGGAGAGCAGTGGG + Intergenic
1149149841 17:53548425-53548447 AGGCGGAAATGGAGAGATGTTGG - Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149395619 17:56239243-56239265 CATAAGAAATGGAGAGAGGTTGG + Intronic
1149406546 17:56357507-56357529 CAGTAGAAAGGGAGAGATGCAGG - Intronic
1149688253 17:58551433-58551455 CAATAGAAATGGAAAGAAATGGG + Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1156050290 18:32924528-32924550 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1156110632 18:33722109-33722131 CTGAAGAAAGGGAGAGAAATGGG - Intronic
1156875920 18:42011488-42011510 TTATAGAAATGGAGAGAATTAGG + Intronic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157514682 18:48302371-48302393 CAGTAAAAAGGGAGAGAAGGTGG - Intronic
1158674659 18:59507291-59507313 TTGTAGAAATGGAGAGACATAGG - Intronic
1158683059 18:59586265-59586287 TGGTTGAAATGGAAAGAAGAGGG - Intronic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1159468298 18:68813817-68813839 CTTTTGAAAGGGAGAGAAGTTGG + Intronic
1161880188 19:6944416-6944438 AGGGAGAAATGGAGAGAAGTAGG + Intergenic
1164324518 19:24180059-24180081 AGGAAGAATAGGAGAGAAGTAGG + Intergenic
1166914120 19:46182959-46182981 TGGGAGAGATGGGGAGAAGTGGG - Intergenic
1202700901 1_KI270712v1_random:162983-163005 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
925480462 2:4265358-4265380 GGGGAGAAATGGAGACATGTTGG - Intergenic
926593152 2:14761092-14761114 CCTTAGAATTGGAGATAAGTGGG + Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
927134460 2:20086625-20086647 TGGTAGTAAGGGACAGAAGTTGG - Intergenic
928021533 2:27708693-27708715 CGGTAGAGATGGGGAGAGATGGG - Intronic
928323049 2:30298720-30298742 CGGTAGAAATACCTAGAAGTGGG + Intronic
928354099 2:30593040-30593062 CGGGAGGGATGTAGAGAAGTTGG - Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
929923370 2:46189422-46189444 GGGTGGAAATGGGGAGATGTTGG + Intergenic
930328882 2:49957212-49957234 CGAAAGAAATCCAGAGAAGTTGG - Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930749751 2:54922896-54922918 GGGTGGAAATGGGGAGATGTTGG + Intronic
930851086 2:55961290-55961312 CTGTAGATCTGGAAAGAAGTTGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932833871 2:75016564-75016586 TGGGAGAAATGCAGAGATGTTGG + Intergenic
933361894 2:81297437-81297459 GGGTAAAAATGGAGAGAAAAAGG - Intergenic
934171828 2:89546472-89546494 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
934282136 2:91620790-91620812 TGGCAGAAAGGGAGAGAACTGGG + Intergenic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
936282202 2:111152030-111152052 AGGAAGAACTGGTGAGAAGTGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936775666 2:115969892-115969914 GGGCAGAAATGGAGAGATGAAGG - Intergenic
936813027 2:116425055-116425077 GGGTAGAAATGGCGAGGAGAAGG + Intergenic
937627902 2:124064446-124064468 TAATAGAAATGGAGAGAAGCAGG - Intronic
938214186 2:129494711-129494733 TGGTAGAAATGGGGAGATGTTGG - Intergenic
938672625 2:133600361-133600383 AGGAAGAAAGAGAGAGAAGTTGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939853406 2:147327204-147327226 GGGAGGAAATGGAGAGATGTAGG + Intergenic
940382008 2:153025699-153025721 CAGCAGATATAGAGAGAAGTGGG - Intergenic
941118411 2:161498952-161498974 TGGGAGAAATGGGGAGATGTTGG - Intronic
941327903 2:164140820-164140842 AGGGAAAGATGGAGAGAAGTTGG - Intergenic
941565550 2:167101466-167101488 TGGGAGAAATGGTGGGAAGTGGG - Intronic
941839834 2:170069577-170069599 TGGGAGAAATGGGGAGATGTTGG - Intronic
941899512 2:170664612-170664634 CAGCAGAAATGGCCAGAAGTAGG + Intergenic
941975948 2:171405553-171405575 GGAGAGAAAAGGAGAGAAGTTGG + Intronic
942535021 2:176954294-176954316 CGGAAGAAATGAAGAGAAGGAGG + Intergenic
942763144 2:179424043-179424065 CTTGAGAAATGGAGAGAATTAGG - Intergenic
943175657 2:184470086-184470108 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
943359995 2:186907566-186907588 CGGAAGAAGTGAAGAGAATTTGG + Intergenic
943799597 2:192041789-192041811 CCGTAGAAAAGGAGAGAGATGGG + Intronic
944386574 2:199171502-199171524 CGGGGGAAAGGGTGAGAAGTGGG + Intergenic
945414923 2:209559175-209559197 CTTTAGAAAAGGAGAGGAGTTGG - Intronic
945519966 2:210814211-210814233 CAGGAGCAATGGAGAGAAGTAGG + Intergenic
946322335 2:218961182-218961204 CGGCAGAAATGGAGAAATGGGGG - Exonic
946895845 2:224322515-224322537 AGGGAGAAACGGAGAAAAGTTGG + Intergenic
947076697 2:226352774-226352796 TGGTAGAACTGGACAGAACTGGG - Intergenic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
947387731 2:229608710-229608732 GGGTAGAGAGGGAGGGAAGTGGG + Intronic
948100408 2:235368446-235368468 CAGTAGCAAAGGAGACAAGTTGG + Intergenic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
1168857003 20:1015585-1015607 AGGGAGAAATGGAGTGAAGGAGG - Intergenic
1169032924 20:2425982-2426004 AGGCAGGAATGAAGAGAAGTTGG - Intronic
1169113687 20:3048946-3048968 TGGGAGACATGGAGAGAAGCTGG - Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169739846 20:8880313-8880335 CGGTAGACAGGGAGAGAACGGGG - Intronic
1169776461 20:9259582-9259604 TGGCAGAGATGGAGAGAAGGAGG + Intronic
1169907385 20:10617477-10617499 TGGGAGATAGGGAGAGAAGTTGG - Intronic
1170124880 20:12951419-12951441 GGGTAGAAAGGGAGAGACATAGG - Intergenic
1172523976 20:35586482-35586504 AGGGAGAAAGGGAGAGAAGGGGG - Intergenic
1173044577 20:39497427-39497449 AGGTAGGAATAGAGTGAAGTAGG - Intergenic
1173083067 20:39888146-39888168 AGTTTGAAATAGAGAGAAGTTGG - Intergenic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1174313314 20:49676712-49676734 AGGCACAACTGGAGAGAAGTTGG + Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1175347828 20:58294921-58294943 AGGCAGAGAAGGAGAGAAGTGGG - Intergenic
1177437120 21:21069787-21069809 AGGTAGACATCGAGAGGAGTTGG - Intronic
1177485463 21:21749549-21749571 AGGGAGAAAGGGAGAGAAGAAGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1178084397 21:29098312-29098334 CAGTAGAAAAAAAGAGAAGTGGG - Intronic
1178507611 21:33175581-33175603 CGGGGGAAATGGGGAGATGTTGG + Intergenic
1178799251 21:35777188-35777210 TGATAGAAAGGGAGAGAAGACGG - Intronic
1180538414 22:16418265-16418287 GGGTAGAACTGGGGAGATGTTGG + Intergenic
1182515468 22:30856216-30856238 GGGCAGAAATGGAGAGATGGAGG - Intronic
1182710837 22:32322287-32322309 TGGTAGAAATGGCCAGAAGCAGG + Intergenic
1182817953 22:33183854-33183876 TAGAAGAAATGGAGAGATGTTGG + Intronic
1183233842 22:36601127-36601149 GGGAAGAAATGGAGAGATATAGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
952214045 3:31258298-31258320 TTGGAGAAATGGAGAGATGTTGG - Intergenic
954517409 3:51190980-51191002 CGGAAGGAATGGAAAGTAGTAGG + Intronic
954908509 3:54083688-54083710 TCTTAGAAATGGAGAGAAATAGG + Intergenic
954987781 3:54810828-54810850 AGGTAGAAATGAAGTGAATTAGG + Intronic
955098577 3:55824261-55824283 TGGTAGAAATGGAGAGAGCCTGG - Intronic
955674151 3:61432989-61433011 GGGTAGAAAGGGAGAGTAGTTGG - Intergenic
956411134 3:68980967-68980989 GGGAAGAAATGGAAAGAACTGGG - Intronic
957271443 3:78035614-78035636 TGGAAGAAATGGGGAGAAGAGGG - Intergenic
957542532 3:81592276-81592298 TGGAGGAAATGGAGAGATGTTGG - Intronic
957574783 3:81993164-81993186 TGTGAGAAATGGAGAGATGTTGG + Intergenic
958593066 3:96185005-96185027 AGGCAGATATGGAGAGATGTTGG + Intergenic
959217160 3:103465676-103465698 AGGGAGAAATGAAGAGAGGTTGG - Intergenic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
960115528 3:113888336-113888358 AGGAAGAAATGGGGAGATGTTGG + Intronic
960141919 3:114159343-114159365 AGGGAGAGATGGAGAGAAGGTGG - Intronic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960677165 3:120206696-120206718 TGACAGAAATGGAGAGATGTTGG - Intronic
960767925 3:121158032-121158054 TGGCAGAAATGGAAACAAGTGGG - Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961155084 3:124672709-124672731 AGGTAGAACAGGAGAGAAATGGG + Intronic
961596703 3:128023360-128023382 TGTTAGAAATGGAAAGAAATAGG - Intergenic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
962597052 3:136956854-136956876 AGGTTGAAATGGCGAGAAATAGG - Intronic
962643057 3:137408204-137408226 TGGTAGAAATGGAGGGAAAAAGG + Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964007635 3:151851255-151851277 ATGGAGAAATGGACAGAAGTAGG - Intergenic
965138285 3:164802916-164802938 GGGTAAGAATGAAGAGAAGTTGG - Intergenic
965440162 3:168702638-168702660 CAGAAGAAATAGAGAGATGTGGG - Intergenic
965834995 3:172841343-172841365 CGGTAGAAGTGGACAGAAGGGGG - Intergenic
966008103 3:175042062-175042084 TGGGAGAAATGGAGAAAAGTTGG - Intronic
966054061 3:175660641-175660663 GGGTAGAAATTAAGAGAAATTGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
968892679 4:3379207-3379229 CGGTAGTGGTGGAGAGATGTTGG + Intronic
969996895 4:11322639-11322661 TGGGAGAAATGGAGAGATATTGG + Intergenic
970693236 4:18643987-18644009 TGGTGGAAATATAGAGAAGTTGG - Intergenic
970787177 4:19813322-19813344 TGAAAGAAATGGATAGAAGTGGG - Intergenic
970934005 4:21546980-21547002 TGGTAGAAAGGAAGAGAAATTGG - Intronic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
971423102 4:26491680-26491702 AGGTACAAATAGATAGAAGTAGG + Intergenic
972273533 4:37535545-37535567 AGGTAGAGGTGGAGCGAAGTGGG - Intronic
972351279 4:38238304-38238326 CTGTAGAAATGTAGGGAATTTGG - Intergenic
972590752 4:40484337-40484359 GGGTCGAAATGGAGAGAATGAGG - Intronic
973716563 4:53682708-53682730 TGGTAAAAATGGTGAGAAGTGGG - Intronic
974777160 4:66499702-66499724 CGGTAGACATGGAGAGACCCTGG - Intergenic
974801147 4:66819714-66819736 TGGGATAAATGGAGAGACGTTGG + Intergenic
974831257 4:67192431-67192453 CAGTAGAAATGGAGAGATAAAGG - Intergenic
975499994 4:75074051-75074073 AGGAGGAAAAGGAGAGAAGTAGG - Intergenic
975823332 4:78293761-78293783 CAGAAAAAATGGAGAGAAGAGGG + Intronic
976038193 4:80849728-80849750 AGGGAGAAATGGTGAGAGGTTGG + Intronic
976076718 4:81307328-81307350 AGGGAGAAATGGGGAGATGTTGG + Intergenic
978465318 4:109002544-109002566 TGGCAGAAATGGGGAGATGTTGG + Intronic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979251969 4:118575165-118575187 TGAGAGAAATGGAGAGAGGTTGG - Intergenic
979435635 4:120686050-120686072 CGGGAGCAAGAGAGAGAAGTGGG - Intronic
979880966 4:125960341-125960363 TGGGGGAAATGGAGAGATGTTGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
980968746 4:139549547-139549569 AGGAAGAAAAGGAGAGAAGGAGG - Intronic
981083974 4:140663889-140663911 GGGGAAAAATGGAGAGATGTTGG + Intronic
981600636 4:146484558-146484580 AGGAAGAAATGGGGAGATGTAGG + Intronic
982322664 4:154096004-154096026 GGGTAAACATGCAGAGAAGTAGG + Intergenic
982665851 4:158261995-158262017 AGGTAGAAATTGAGAGAGATTGG - Intergenic
982691394 4:158551308-158551330 GGGGAAAAATGGAGAGATGTTGG + Intronic
982974512 4:162037110-162037132 TGGTAGAAATTGAGAGGATTAGG + Intronic
983951539 4:173648175-173648197 AGGTAGGAATGCAGAGATGTAGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984537590 4:180996222-180996244 AAGGAGAAATGGAGAGATGTTGG - Intergenic
984579024 4:181488305-181488327 CAGTACAATTGGTGAGAAGTCGG + Intergenic
984646737 4:182228083-182228105 AGGAGGAAATGGAGAGATGTGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985069408 4:186153182-186153204 TGATAGAAATGGAGGGAAGGTGG + Intronic
985207933 4:187560929-187560951 GGGTAGAAATGGAAAGATCTGGG - Intergenic
985778177 5:1856299-1856321 GGGGAGAGATGGAGAAAAGTAGG + Intergenic
986153656 5:5151873-5151895 AGGAAAAAATGGGGAGAAGTAGG - Intronic
986927547 5:12775378-12775400 TGGGAGAAATAGAGAGATGTTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987777402 5:22385849-22385871 CAGGAGAAAGGGAGAGAAGGTGG + Intronic
987879531 5:23725030-23725052 AGGAAGAAATGGAGAGAAGGGGG - Intergenic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988367032 5:30313640-30313662 AGGCGGAAATGGGGAGAAGTTGG - Intergenic
988421619 5:31012614-31012636 GGGTACAAATGAAGAGAACTAGG - Intergenic
990630963 5:57668283-57668305 CTGCAGAAATGGAGAAAACTGGG + Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
993844914 5:92929567-92929589 TGGTAGAGATAGAAAGAAGTGGG + Intergenic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
994607360 5:101985863-101985885 CGGAAGTACTGGAGAGTAGTTGG - Intergenic
995688805 5:114800421-114800443 AGGGAGAAAGGGAGAGAAGGAGG + Intergenic
995752072 5:115462520-115462542 AGGGAGAAATGAAGAGAAGTTGG - Intergenic
996145688 5:119972278-119972300 GGGAAGAAATGGGGAGATGTAGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996290148 5:121843097-121843119 AGGGAGAAATGGGGAGATGTAGG + Intergenic
996321839 5:122226331-122226353 GGGAAAAAATGGAGAGATGTAGG + Intergenic
996339006 5:122415568-122415590 AGTTGGAAATGGAGAGAAGAGGG + Intronic
996456518 5:123689989-123690011 TGGTAGAAATGGTGAGTAGAAGG + Intergenic
997305217 5:132831156-132831178 TGGGAGAAATGGAAAGAAATGGG - Intergenic
998400691 5:141847359-141847381 GAGTAGAAATGGAGGGGAGTTGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999483280 5:151968575-151968597 AGGGAGAAATGGGGAGATGTTGG - Intergenic
999512603 5:152268321-152268343 AGTTAGAAATGGTGAGAACTAGG + Intergenic
1001075356 5:168623069-168623091 TGGAAGAAATGGGGAGATGTTGG - Intergenic
1001084199 5:168688438-168688460 CTTTAGGAATGGATAGAAGTGGG + Intronic
1001428726 5:171643004-171643026 CGTCAGAAAAGGAAAGAAGTTGG - Intergenic
1001665206 5:173427114-173427136 GGGAGGAAAAGGAGAGAAGTAGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002765663 6:236494-236516 GGGCAGTAATGGAGAGAAGGAGG + Intergenic
1002883475 6:1273404-1273426 GGGTAGAAATGAAGAGAGGTTGG + Intergenic
1003745031 6:8991162-8991184 GGGAAGAAATGGGGAGATGTAGG + Intergenic
1004859520 6:19787876-19787898 AGGTAGAAAAGGAGAGAATGAGG - Intergenic
1005286549 6:24333856-24333878 TGGCAGAAGTGGAGAGAAGAGGG + Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005907293 6:30274577-30274599 TGGGAGAAATGGGGAGATGTTGG + Intergenic
1006207415 6:32360171-32360193 TGGAAGAAATGGGCAGAAGTTGG - Intronic
1006254352 6:32818152-32818174 GGGTAGAAATGGGTAGAGGTTGG + Intronic
1007060052 6:38930894-38930916 TGGGAGAAATGGGGAGATGTTGG - Intronic
1007463511 6:42035322-42035344 CAGTAGAAATGGAAACAAGGGGG - Intronic
1008402448 6:51079414-51079436 CTGTATAAGTGAAGAGAAGTGGG + Intergenic
1008640561 6:53458280-53458302 TGCTAGAAAGGAAGAGAAGTAGG - Intergenic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1010805953 6:80237099-80237121 AGGTAGAAATTGAGAGAGTTTGG + Intronic
1011943172 6:92868677-92868699 TGGTAGAAATTGAGGCAAGTGGG - Intergenic
1012027438 6:94014752-94014774 CGGTAGCAAAGGAAAGAAGAAGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1013688543 6:112613536-112613558 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1013922832 6:115429507-115429529 TGGGAGAAATGGGGAGAAGTTGG + Intergenic
1015416795 6:132958201-132958223 AGGAAGAAAAGGAGAGAAGAAGG + Intergenic
1016039835 6:139421501-139421523 GGGTGGAAAGGGAGAGCAGTAGG - Intergenic
1016136004 6:140543988-140544010 CTGGAGAAAGAGAGAGAAGTGGG - Intergenic
1016279725 6:142401729-142401751 GTGGAGAAATGGAGAGAATTTGG + Intronic
1016342032 6:143073011-143073033 GGGAGGAAATGGGGAGAAGTAGG - Intronic
1016457857 6:144249818-144249840 AGGAAGAAAAGGAGAGGAGTGGG - Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017425083 6:154312317-154312339 GGGAAGGATTGGAGAGAAGTTGG + Intronic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1017783221 6:157732864-157732886 TGGCAGAAATGGAGAGATGTTGG - Intronic
1018406614 6:163490776-163490798 TGGAAGAGATGGACAGAAGTGGG + Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023472647 7:40541277-40541299 TGGCAGAAATGTAGAGATGTGGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025111460 7:56220174-56220196 AGGAAGAAAGGGAGAGAAGGAGG + Intergenic
1026260470 7:68750865-68750887 TGGGAGAAATGGGGAGATGTCGG - Intergenic
1027279980 7:76602092-76602114 TGGTGGAAATGGATAAAAGTGGG + Intergenic
1027732429 7:81891800-81891822 GGGGAGAGATGGAGAGATGTTGG + Intergenic
1028696370 7:93717676-93717698 AGGAAGAAATGGGGAGAAATGGG + Intronic
1031672778 7:124570734-124570756 CAGGAGAAATGGGGAGATGTTGG - Intergenic
1032443750 7:131962337-131962359 GGGTAGAAATGGTTAGAACTAGG - Intergenic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1036670491 8:10782175-10782197 GGATAGAAATGGGGAGATGTAGG + Intronic
1037394103 8:18423948-18423970 GGCTAGAAATGGAGACGAGTGGG - Intergenic
1039845106 8:41320532-41320554 GGGTAGAAAGGGAGAGAACAAGG - Intergenic
1039913526 8:41843379-41843401 GGGGGGAAATGAAGAGAAGTGGG - Intronic
1040686544 8:49879721-49879743 CGGGGAAAATGGAGACAAGTTGG - Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042070971 8:64933164-64933186 TGGTAGAAATGTAGAGAAAGAGG - Intergenic
1042223765 8:66498957-66498979 AGCTAGAAATGGATAGAACTGGG - Intronic
1043346657 8:79305450-79305472 TGGGAGAAATGGGGAGATGTTGG - Intergenic
1043881597 8:85549635-85549657 GGGTAGGCATGGTGAGAAGTGGG + Intergenic
1044340055 8:91036542-91036564 TGGTAGAGATGGAGAGATGAAGG - Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048020173 8:130531071-130531093 GGGTTGAAGTGGAGAGGAGTAGG + Intergenic
1048709043 8:137187479-137187501 GGACAGAACTGGAGAGAAGTAGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050489699 9:6175299-6175321 AGGTAGGGATGAAGAGAAGTTGG + Intergenic
1051058661 9:13019631-13019653 TGGTAAAAATGTGGAGAAGTTGG - Intergenic
1051194198 9:14545536-14545558 GGGGAGAAATGGAAAGAAGACGG + Intergenic
1051675091 9:19551105-19551127 AGGGAGAAATGAAGAGAGGTCGG - Intronic
1051698270 9:19791603-19791625 TGGTAGTAATGGAGAAAAGCAGG + Intergenic
1052148406 9:25079178-25079200 TGGGAGAAATGGAGAGAAACTGG - Intergenic
1052247587 9:26355331-26355353 TGGGAGAAATGGAAAGATGTTGG + Intergenic
1052685420 9:31749335-31749357 AGGGAGAAATAGAGAGATGTTGG + Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1056932791 9:90892726-90892748 CCTTGCAAATGGAGAGAAGTTGG + Intronic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1059905285 9:118977141-118977163 TGGTAGAAATGAAGAGGAGTGGG + Intergenic
1059917099 9:119116287-119116309 ACCTAGAAATGGAGAAAAGTGGG + Intergenic
1060148982 9:121275213-121275235 CCGAAGAAGTGGAGAGAACTTGG + Intronic
1061050251 9:128191123-128191145 CGCCAGAAATGGAGAGATGGAGG - Intronic
1061080945 9:128369911-128369933 GGGCAGAAATGGAATGAAGTTGG - Intergenic
1185922232 X:4106538-4106560 TGGGGGAAATGGAGAGATGTTGG - Intergenic
1186380304 X:9051430-9051452 AGGTAGAGATGCAGAGAAGGAGG + Intronic
1186716624 X:12258944-12258966 AGGGAGAAATGAAGAGAGGTTGG - Intronic
1187148505 X:16659899-16659921 TGGGAGAAATGGGGAGATGTTGG - Intronic
1188465058 X:30470367-30470389 CAGTAGAAATGGTGAGTAGTGGG - Intergenic
1188658088 X:32723515-32723537 TGGAAGAAATGAGGAGAAGTAGG + Intronic
1188859691 X:35242712-35242734 CGGGAGAAAGAGAGTGAAGTGGG - Intergenic
1189684955 X:43554325-43554347 TTGTAGAAATGGACAGAGGTGGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1193193800 X:78605834-78605856 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
1193704120 X:84800108-84800130 CGGGAGGAATAAAGAGAAGTTGG - Intergenic
1193965269 X:87976837-87976859 CAGGAGAAAGAGAGAGAAGTGGG - Intergenic
1194470896 X:94295607-94295629 CTCAAGAAATGGAGAGAAGGAGG + Intergenic
1194568309 X:95521494-95521516 CAGTAGAAAGGGAGAAAAGGAGG + Intergenic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195413867 X:104599060-104599082 TGATAGAAATGGGGTGAAGTGGG + Intronic
1195756137 X:108200613-108200635 GGGGAGAGATGGAGAGAGGTTGG + Intronic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1198187408 X:134266951-134266973 CAGGAGAAGGGGAGAGAAGTGGG + Intergenic
1198322015 X:135527656-135527678 AGGTAGAATTGAAGAGAAATAGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1198602530 X:138299664-138299686 TGGTTGTAATGGAGAGAATTGGG + Intergenic
1198919740 X:141712139-141712161 TGTTAGACATGGTGAGAAGTGGG + Intergenic
1199284537 X:146041639-146041661 GGGTATAGATGGAGTGAAGTGGG + Intergenic
1199466747 X:148146536-148146558 AGGTAGAAAGGGACAGATGTTGG - Intergenic
1199827046 X:151510534-151510556 AGGGAGAAACGGAGAGAGGTAGG + Intergenic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1202379274 Y:24261556-24261578 GGGGAGAAAGGGAGAGAAGAAGG - Intergenic
1202491508 Y:25408565-25408587 GGGGAGAAAGGGAGAGAAGAAGG + Intergenic