ID: 1016612631

View in Genome Browser
Species Human (GRCh38)
Location 6:146009719-146009741
Sequence CAATTGGAATCTCTTGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016612629_1016612631 17 Left 1016612629 6:146009679-146009701 CCTTTTCTTCTCATGCTTTTGGC No data
Right 1016612631 6:146009719-146009741 CAATTGGAATCTCTTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016612631 Original CRISPR CAATTGGAATCTCTTGCCTC AGG Intergenic
No off target data available for this crispr