ID: 1016613817

View in Genome Browser
Species Human (GRCh38)
Location 6:146024529-146024551
Sequence GGCCTATGGCCTCTTTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016613814_1016613817 2 Left 1016613814 6:146024504-146024526 CCTGTTGGCTTTCTGACTTGCAT No data
Right 1016613817 6:146024529-146024551 GGCCTATGGCCTCTTTGTTCTGG No data
1016613813_1016613817 3 Left 1016613813 6:146024503-146024525 CCCTGTTGGCTTTCTGACTTGCA No data
Right 1016613817 6:146024529-146024551 GGCCTATGGCCTCTTTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016613817 Original CRISPR GGCCTATGGCCTCTTTGTTC TGG Intergenic
No off target data available for this crispr