ID: 1016614218

View in Genome Browser
Species Human (GRCh38)
Location 6:146028353-146028375
Sequence GTCCCTTGCAGGCCCTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016614218 Original CRISPR GTCCCTTGCAGGCCCTGCCA GGG Intronic
900329662 1:2127741-2127763 GTCCCTGGCAGCCCCTGGCCAGG + Intronic
900494269 1:2969384-2969406 GTCCCTGCTTGGCCCTGCCAGGG - Intergenic
900545999 1:3229537-3229559 GTGGCTTGGAGGCCCTGACAGGG - Intronic
900887717 1:5427288-5427310 GTCCCTTGCACTCCCTTCCACGG + Intergenic
901773896 1:11545932-11545954 GTTCTTTGCAGCCACTGCCATGG - Intergenic
902387819 1:16085803-16085825 GAGCCTCCCAGGCCCTGCCAAGG + Intergenic
903000622 1:20262986-20263008 GGCTCTTCCAGTCCCTGCCACGG + Intergenic
903665303 1:25003475-25003497 ATCCATTGAAGGCCCTGCCTGGG - Intergenic
904577934 1:31517451-31517473 CCCCATTGCAGGCCCTGCGAGGG - Intergenic
904600290 1:31669150-31669172 GTCGCTGGTATGCCCTGCCATGG + Intronic
904662524 1:32095843-32095865 GTCCCTTTCAGGCTCTGTCCTGG + Intronic
905173002 1:36120010-36120032 CTCCCTTGCAGGACCCACCAGGG + Intronic
905476148 1:38229587-38229609 CTTCTTTGCAGGCCCTGCCTGGG + Intergenic
906286516 1:44591377-44591399 TGCCCTTGCAGGCCTTGCTAAGG + Intronic
906715992 1:47969760-47969782 GTCCCTTGCAGAGCCAGCCCTGG + Intronic
906785384 1:48611011-48611033 GACCCTAGAAGGCCCTGCCCTGG - Intronic
906820217 1:48921307-48921329 GTCCAGCACAGGCCCTGCCATGG - Intronic
907184987 1:52602590-52602612 GTCCCCAGCAGGCCCCGCCAGGG - Intronic
909238295 1:73180745-73180767 GCCCTTTCCAGGCCCTCCCATGG - Intergenic
911051754 1:93677392-93677414 GAGTCTTGAAGGCCCTGCCAAGG + Intronic
911657508 1:100461595-100461617 GGCCTTTGCAGGCCTTGCAATGG - Intronic
915229136 1:154432863-154432885 GTCTCTTCCAGGCCCTGCAGTGG - Intronic
917854842 1:179091756-179091778 CTGCCTTCCAGCCCCTGCCAAGG + Intronic
921991484 1:221372270-221372292 CCCCCTTGCAGGGCGTGCCATGG + Intergenic
922774763 1:228209527-228209549 ATCCCCAGCTGGCCCTGCCAGGG - Intronic
923340688 1:233004578-233004600 GTCCCAGGCCGGCCCTGTCAGGG - Intronic
1062953100 10:1519987-1520009 GTCCCTTGCTGTCCCTACCTGGG + Intronic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1063900966 10:10732147-10732169 GTCCCTAGCCCTCCCTGCCAAGG - Intergenic
1064295707 10:14077157-14077179 GTCCCTTGCAGTGCCTACCCAGG - Intronic
1065972320 10:30815359-30815381 GTCCCATGCAGGCCCAGACTAGG + Intergenic
1066733271 10:38451727-38451749 GACCTTTGCAGGCCCGGCCTCGG + Intergenic
1067472394 10:46546553-46546575 GTCCCTTTCAGGCCCTGCTCTGG - Intergenic
1068936084 10:62636990-62637012 GCCCCCTGCAGGCCCTACAATGG - Intronic
1069898785 10:71695348-71695370 TCCCCTGGCAGGCCCTGCCCTGG + Intronic
1070748341 10:78948647-78948669 GTCCCTTCCAGGCCCAGCAGGGG - Intergenic
1070820211 10:79349951-79349973 GTCAGTGGCAGGCCCTGCCCGGG + Intronic
1070845775 10:79521863-79521885 GTCCCTTGGAGGCTTGGCCAGGG + Intergenic
1070928018 10:80238455-80238477 GTCCCTTGGAGGCTTGGCCAGGG - Intergenic
1071493571 10:86152835-86152857 GTGCCTTGCCAGCCCTGACAGGG + Intronic
1075095617 10:119468902-119468924 CTCCCTTCCAGGCTCTGCCTTGG - Intergenic
1075582981 10:123636163-123636185 GTACCAAGCAGGACCTGCCATGG + Intergenic
1076009296 10:126974518-126974540 GCCACTTGCAAGCCGTGCCAGGG + Intronic
1076711669 10:132339107-132339129 GTCCCACCCAGGCCCTGCCGTGG - Intronic
1076947239 10:133659728-133659750 GTCCATGGCAGGCTCTGCCTGGG + Intergenic
1077200012 11:1302062-1302084 CTGCCTTGAAGGCCCTGCAAGGG + Intronic
1077252503 11:1566806-1566828 GGCCTTTGCAGGCCATGCCGAGG - Intronic
1077287441 11:1773860-1773882 GTGCCTGCCAGGCCCTCCCAGGG - Intergenic
1077434124 11:2530355-2530377 GTCCTTTGCTGGTTCTGCCATGG + Intronic
1077533920 11:3110041-3110063 GTCCCATGCAGGCCCGGGGATGG - Intronic
1077672375 11:4167850-4167872 TTCCCTGGCTGTCCCTGCCATGG - Intergenic
1078530370 11:12132178-12132200 GTTCCTCGCAGTCCCAGCCAGGG + Intronic
1080048063 11:27830303-27830325 GTCCTTTGCAGGCCATGTCAAGG - Intergenic
1081330045 11:41791096-41791118 CTCCATTGCATGCCCTGCAAGGG + Intergenic
1083272590 11:61579901-61579923 GTCCCCTGCAGCTCCTGCCCAGG - Intronic
1083424125 11:62574242-62574264 GTCCCTCTCTGGCCCTCCCAGGG + Exonic
1083427174 11:62594224-62594246 GTCCCTCTCAGCCCCTCCCATGG + Intronic
1084089702 11:66871508-66871530 GTACCTTGCAGTCCCTTCCAAGG + Intronic
1084269421 11:68021171-68021193 GTCCCCTGCAGGGTCAGCCAGGG + Intronic
1084611089 11:70203441-70203463 GCCGCTTGCAGACCCCGCCATGG + Exonic
1085237191 11:75024199-75024221 GTCCCATGCAGGCCCTGTGCTGG - Intergenic
1085298072 11:75442205-75442227 GTCCCATGATGACCCTGCCAGGG + Intronic
1085796279 11:79542940-79542962 GTCCCTCTGAGGACCTGCCATGG + Intergenic
1089043047 11:115471972-115471994 TCCCCTTGCAGTGCCTGCCATGG - Intronic
1089169004 11:116499671-116499693 GCCCCTTGCATGCCCTGCACAGG - Intergenic
1091167315 11:133491231-133491253 CTCCCTTGCTGGGCTTGCCAGGG + Intronic
1091836545 12:3590112-3590134 ATCCCTTTCAGACCCTGCCTGGG - Intronic
1092465228 12:8725602-8725624 CCCCCTTGCAGCCTCTGCCAGGG - Intronic
1096624664 12:52887107-52887129 GTCCCTTGCAGAGGATGCCAGGG + Intergenic
1098090088 12:66892207-66892229 GTCCCTTCCAGGCTGTGCAATGG - Intergenic
1101280002 12:103243807-103243829 CTTCCTTGCTGGCACTGCCATGG - Intronic
1102543094 12:113636409-113636431 GTCCCTGGGAGTCCCTGGCAAGG - Intergenic
1104552765 12:129772560-129772582 GACCTTTGCAGACCATGCCACGG - Intronic
1105306473 13:19172561-19172583 GTCCCCTGCACACACTGCCAAGG + Intergenic
1105730131 13:23205453-23205475 GTCACTCCCAGGCCCTTCCATGG - Intronic
1106079143 13:26486079-26486101 GTCCCTAGCAGGCCTCGGCAGGG - Intergenic
1107919753 13:45192962-45192984 GTCACTTCCAGGACCAGCCAGGG + Exonic
1108576556 13:51796279-51796301 GTCTCCTCCAGGCTCTGCCAGGG - Intronic
1108642505 13:52395832-52395854 GCAGCATGCAGGCCCTGCCAAGG + Intronic
1109151649 13:58856227-58856249 GTCCCTCGCAGGGCATGCGATGG + Intergenic
1113962585 13:114133497-114133519 GTCCCCTGCAGACCCCGGCATGG + Intergenic
1117197598 14:53355962-53355984 GGCCCTGGCAGGCCCAGGCAAGG - Intergenic
1120390997 14:83908608-83908630 GTCCCCGGCAGCACCTGCCAGGG - Intergenic
1120854588 14:89201653-89201675 GTCCCTGGCTGGCCGTGCCCAGG - Intronic
1121447403 14:93987760-93987782 GTCTCCTGCAGCCCCTGTCACGG - Intergenic
1122418136 14:101560162-101560184 GGCCCTGGCCGGCCCTGCCGCGG - Intergenic
1122785760 14:104162663-104162685 CTCCCCTGCAGCCCCTCCCAAGG - Intronic
1202921300 14_KI270723v1_random:32281-32303 GTCCATGGCAGGCTCTGCCTGGG + Intergenic
1202923610 14_KI270724v1_random:5299-5321 GTCCATGGCAGGCTCTGCCTGGG - Intergenic
1124394652 15:29290793-29290815 GACTCTTGCAGCTCCTGCCAGGG + Intronic
1124413684 15:29457431-29457453 GTCCCTTGCAGAGTCTTCCATGG + Intronic
1124619847 15:31267388-31267410 TTCACTTCCTGGCCCTGCCATGG - Intergenic
1127017753 15:54708123-54708145 GCCTCTTCCAGGCCCTCCCATGG - Intergenic
1127918073 15:63471825-63471847 GGACCTTGAATGCCCTGCCAAGG + Intergenic
1128067994 15:64775992-64776014 GTCCCTGGGCGGCCCTGCCCGGG + Intergenic
1130020751 15:80229222-80229244 GTCCCTTCCAGCCCCAGTCAGGG - Intergenic
1130441269 15:83956266-83956288 GTGCCATGCAGCCACTGCCAGGG + Intronic
1131058631 15:89391117-89391139 GCCCCTTGCAGGTCCTGGGATGG + Intergenic
1131064659 15:89426499-89426521 GTCCCCTGAAGGCCCTCACATGG + Intergenic
1131827630 15:96333389-96333411 GGCCCTTACAGGCCCTGCCCAGG + Intronic
1132669103 16:1095427-1095449 GGCCCCTGCAGGCCCTGCCCTGG - Intronic
1133250332 16:4476547-4476569 GTCCTTCGCGGGCCCTGCCTCGG + Intronic
1136537273 16:30907417-30907439 CTGCCTCCCAGGCCCTGCCATGG - Intergenic
1136574083 16:31113001-31113023 GTCCCTGCTAGGGCCTGCCAAGG - Intergenic
1136746757 16:32597635-32597657 GCCCATTGCAGTGCCTGCCACGG + Intergenic
1136909064 16:34131881-34131903 GTCCCTTGTAAGCCATGCAAAGG + Intergenic
1137564955 16:49527085-49527107 GTCTCTGCCAGCCCCTGCCAGGG - Intronic
1137735570 16:50720538-50720560 CTCCCTGGCAGGCCCTAGCATGG - Intronic
1138558819 16:57788075-57788097 CACCATGGCAGGCCCTGCCAGGG + Intronic
1138558820 16:57788077-57788099 TTCCCTGGCAGGGCCTGCCATGG - Intronic
1139449513 16:67018353-67018375 GTCCTTTCCAGGCCATGCCCTGG + Intergenic
1139509186 16:67416562-67416584 GTCCCTGGCAAGCCCCGCCCTGG - Intronic
1141443278 16:84042852-84042874 GCCCCCTGCAGGCCCGGCCCCGG + Intergenic
1203048886 16_KI270728v1_random:856839-856861 GCCCATTGCAGTGCCTGCCACGG + Intergenic
1143037318 17:4006866-4006888 GTCCCATGCACGCCCCACCAAGG + Exonic
1143590263 17:7881767-7881789 CTACCTTCCAGGCCCTGCCACGG - Intronic
1144586263 17:16489755-16489777 GGCCCTTGCATCCCCAGCCAGGG + Intronic
1144732381 17:17536238-17536260 CTCCCTTGCAGGACTTGCCAAGG + Intronic
1146281703 17:31549408-31549430 TCCCCTTGCAGCCCCTGGCAAGG - Intergenic
1146459442 17:33033793-33033815 GCCCCTTCCAGGCCCACCCATGG + Intronic
1147140000 17:38455476-38455498 ATTCCATGCAGGCCCTCCCAGGG + Intronic
1149658810 17:58324108-58324130 CTCCCTTCCAGGGCCAGCCAGGG + Intronic
1150589983 17:66553772-66553794 TTCCCTCACAGGCCCTGGCACGG - Intronic
1150611479 17:66737031-66737053 GCCACTTGCAAGCCCTGCAACGG - Intronic
1150633107 17:66894101-66894123 ACCCCTCTCAGGCCCTGCCAAGG + Intergenic
1150643296 17:66964025-66964047 GGTCCTTCCAGGCCCTGCAAGGG + Intergenic
1151423929 17:74017373-74017395 CTGCCTTGGAGGCCCGGCCAAGG - Intergenic
1151731732 17:75915284-75915306 GTGCCTGGGAGGCACTGCCAGGG + Intronic
1151973775 17:77472471-77472493 GTCCCTTCCAGGTCCTGCAAAGG + Intronic
1152269807 17:79317561-79317583 TTCACTAGAAGGCCCTGCCACGG - Intronic
1152611585 17:81317526-81317548 GTCCCTTGCTGTCCCTGGCTGGG + Intronic
1152875302 17:82783051-82783073 CTCCCTGGCAGAACCTGCCACGG - Intronic
1156422133 18:36966009-36966031 GTTCCTTGCTAGGCCTGCCATGG + Intronic
1157907173 18:51579668-51579690 TTCCTTTGCAGTCACTGCCACGG + Intergenic
1159394641 18:67839638-67839660 GTCCCATGCTGCCACTGCCAGGG + Intergenic
1159681229 18:71354986-71355008 CACACTTGCAGACCCTGCCAGGG - Intergenic
1160406004 18:78646810-78646832 GGACCCTTCAGGCCCTGCCACGG + Intergenic
1161006560 19:1940260-1940282 TCCCCTTCCAGGCCCTGTCATGG + Intergenic
1161595598 19:5149632-5149654 GTCCCATGAAGGGCGTGCCAGGG - Intronic
1162301467 19:9847456-9847478 GTCCCTTGCAGAGCCCACCAGGG + Intronic
1163187217 19:15647176-15647198 GGCCCTTGGCTGCCCTGCCAGGG + Exonic
1163252418 19:16133959-16133981 GCCCCTAGAAGGACCTGCCAGGG - Exonic
1164552358 19:29222143-29222165 GTCTCTTGCAGGGCAAGCCAGGG - Intergenic
1164800982 19:31076387-31076409 TTCAATTGCAGGCCCTGCAAAGG - Intergenic
1167048581 19:47065886-47065908 CTTCCACGCAGGCCCTGCCATGG + Exonic
1167896618 19:52586932-52586954 GTCCCCTGCAGGCCTCGCCCCGG + Exonic
925867752 2:8244025-8244047 GACCCTGGCTGGCCCCGCCAGGG + Intergenic
925994955 2:9284688-9284710 GTTCCTTGCAGTGGCTGCCATGG + Intronic
926133095 2:10317783-10317805 GACCATTGGAGGCCCTGCCCTGG + Intronic
929310810 2:40421999-40422021 GTGCCTTGCAGTTCCTGCCCTGG - Intronic
929760384 2:44801841-44801863 GCCCCCTGCAGCCCCAGCCAAGG - Intergenic
930247965 2:49004101-49004123 GCCCCAGGCAGGCCCTGCCAAGG + Intronic
930858676 2:56046008-56046030 GTACTTTGCAGACCTTGCCAAGG - Intergenic
931868769 2:66438179-66438201 CCCCCTTGCGGGCACTGCCATGG - Intronic
932126954 2:69153168-69153190 GTGCCTTGCCGGCCCTTCCATGG - Intronic
933258488 2:80106889-80106911 GTCCTTTGGGGGCCCTGGCAGGG + Intronic
934056042 2:88252608-88252630 CTCTTTTGGAGGCCCTGCCAGGG - Intergenic
934563207 2:95323765-95323787 CTCCCTAGCAGCCCCTGCCCTGG + Intronic
934655306 2:96114253-96114275 GTCCCTGGCAGGCGCTGGGATGG - Exonic
935597336 2:104889468-104889490 GTCGGTTGCAGGTTCTGCCACGG + Intergenic
936098767 2:109555934-109555956 GTTCCTTCCAAGCACTGCCATGG + Intronic
937587153 2:123566689-123566711 ATCCCTTGCTGGCCCTGAGATGG + Intergenic
937602420 2:123754665-123754687 GTCATTTGGAGGCTCTGCCAGGG + Intergenic
938042993 2:128091351-128091373 CTCCCTTGCAGCCCATGCCCGGG - Exonic
938079916 2:128364496-128364518 GCTCCTTCCAGGCCCGGCCAGGG + Intergenic
939825798 2:147014312-147014334 ATACCTTGTAGGCCCTGCAATGG + Intergenic
940360547 2:152791463-152791485 GCCCATTGCACGCCCTGCGAGGG + Intergenic
946032562 2:216716683-216716705 GTCCCCTGCTGACCCTGCCAAGG + Intergenic
946692542 2:222320045-222320067 GTCGCTCGCCGGCGCTGCCATGG + Intergenic
947594163 2:231400382-231400404 GTGCCTTCCTGTCCCTGCCAAGG + Exonic
948102236 2:235384458-235384480 GTACATTCCAGTCCCTGCCAGGG + Intergenic
948273401 2:236690890-236690912 GTCCCCTGCTGGCCCTGGCATGG + Intergenic
948373112 2:237503264-237503286 TTCCCCTCCAGGCCCTGCCTTGG - Intronic
1168806084 20:673099-673121 GTCCACTGCAGACACTGCCAAGG + Intronic
1169609935 20:7367271-7367293 TCCTCTTGAAGGCCCTGCCAAGG - Intergenic
1169942330 20:10950580-10950602 GTCCCCTGCAGGCCCTAAGAAGG - Intergenic
1170101750 20:12708742-12708764 ATCCCCTTCAGGCCCTGGCAAGG - Intergenic
1170879511 20:20283729-20283751 CTTCCTTGCTGGCCCAGCCAGGG + Intronic
1171488195 20:25498637-25498659 GTCCCCTGCAGGCCCTTCATGGG + Intronic
1171810281 20:29741426-29741448 GGCCCCAGCAGGCCATGCCAGGG + Intergenic
1171813932 20:29766053-29766075 GTCCCTTGTAAGCCATGCAAAGG - Intergenic
1171904523 20:30890651-30890673 GTCCCTTGTAAGCCATGCAAAGG + Intergenic
1172749176 20:37237812-37237834 TTCCCTTGCAGCACCTGCCTGGG + Intronic
1173654427 20:44689995-44690017 GTCCCTTGCAAGTCCTTCCTCGG - Intergenic
1174085946 20:48007120-48007142 GTCCCTTCCAGGCCCAGTCCAGG + Intergenic
1176071746 20:63230543-63230565 TCCCCTTGCAGGGCCTGCGATGG + Intergenic
1176330583 21:5545654-5545676 GTCCATGGCAGGCTCTGCCTGGG - Intergenic
1176376716 21:6090390-6090412 GTCCCTGCCTGGCCCTCCCACGG - Intergenic
1176397174 21:6275297-6275319 GTCCATGGCAGGCTCTGCCTGGG + Intergenic
1176429476 21:6567164-6567186 GGGCCTTGCAGACCCTGCCAAGG - Intergenic
1176439983 21:6713807-6713829 GTCCATGGCAGGCTCTGCCTGGG - Intergenic
1176464245 21:7040876-7040898 GTCCATGGCAGGCTCTGCCTGGG - Intergenic
1176487806 21:7422655-7422677 GTCCATGGCAGGCTCTGCCTGGG - Intergenic
1178306263 21:31493141-31493163 GTACCATGCAGGCTCTGCAAAGG + Intronic
1179704870 21:43174626-43174648 GGGCCTTGCAGACCCTGCCAAGG - Intergenic
1179746759 21:43447854-43447876 GTCCCTGCCTGGCCCTCCCACGG + Intergenic
1180317383 22:11286676-11286698 GTCCCTTGTAAGCCATGCAAAGG - Intergenic
1180337945 22:11596788-11596810 GTCCCTTGTAAGCCATGCAAAGG + Intergenic
1181043032 22:20201805-20201827 GTCCCATCCAGCCCCTGCCCAGG - Intergenic
1181266818 22:21635390-21635412 GTGAGGTGCAGGCCCTGCCAGGG - Intronic
1182097016 22:27632951-27632973 GCCCCCCTCAGGCCCTGCCAGGG + Intergenic
1182228647 22:28819733-28819755 GGAGCTTGCATGCCCTGCCAGGG - Intergenic
1183381835 22:37494120-37494142 GTCCCCTGCAGGCGCCCCCACGG + Exonic
1183516523 22:38270052-38270074 GACCTTTGGAGGCCCCGCCAAGG - Intronic
1184713680 22:46268204-46268226 GTCCCTTCCAGGCGTTGCCGCGG - Intronic
1184857285 22:47153406-47153428 GTACTTGGCAGCCCCTGCCATGG + Intronic
950478417 3:13228629-13228651 ACTCCTTGCAGGCCCTGCAAAGG - Intergenic
950627002 3:14254532-14254554 GGCCATTGCAGGCCCTGCTGAGG - Intergenic
950780321 3:15386185-15386207 GTAACTTCCAGGCACTGCCATGG + Intronic
957080217 3:75630688-75630710 GTCCATGGCAGGCTCTGCCTGGG - Intergenic
957621786 3:82603856-82603878 GCACCTTGCAGCCACTGCCAAGG - Intergenic
960967569 3:123115818-123115840 CTCATTTGCAGGCCCTGCCTGGG + Intronic
961450745 3:127001280-127001302 ATGCCTTGCAGGCCGGGCCAGGG + Intronic
961952184 3:130761762-130761784 GTACCATGCAGCCACTGCCAGGG - Intergenic
962187195 3:133272577-133272599 GTACCTTGCAGGTCCCCCCAAGG + Intronic
963046250 3:141104665-141104687 CGCCCTGGCAGGCCCTGCCCAGG - Intronic
968084485 3:195868256-195868278 GTCCCTGCCGGGCCCAGCCAGGG - Exonic
968666357 4:1824399-1824421 GGCCCTTGCAGGCTCTGCACAGG + Intronic
968941042 4:3637893-3637915 GTCCTTTGCTGGCCTGGCCACGG - Intergenic
972687024 4:41361238-41361260 GCCGCTTCCAGGCGCTGCCAAGG + Intronic
975272329 4:72450349-72450371 GTGCCTTGCATGCTCTTCCATGG - Intronic
977809738 4:101346165-101346187 GTCCTGTGCAGGCCCTTCCAGGG + Intronic
979527167 4:121729435-121729457 CTCCCTGACAGGCCCTGGCATGG + Intergenic
980100635 4:128538538-128538560 GCCCCTTGCACGCCCTGCAAGGG - Intergenic
982652871 4:158108873-158108895 CTCCCTTGAAGACCCTGCTAAGG - Intergenic
985450697 4:190060528-190060550 GTCCATGGCAGGCTCTGCCTGGG + Intergenic
985551607 5:535963-535985 GTCCCTGGCTCGCCCTGCCCAGG - Intergenic
988595277 5:32585445-32585467 GTCCCTTTAAGGCCCTGGAAAGG + Intronic
995979064 5:118079200-118079222 CTCCCTTGCAGGACGTGCGATGG - Intergenic
996194680 5:120589602-120589624 GTGCCTTTCACCCCCTGCCATGG - Intronic
996594382 5:125184702-125184724 GTACCATGCAGGGGCTGCCAGGG - Intergenic
997309285 5:132866480-132866502 GTGCCTTGGAGGCCCTGCCCGGG - Intronic
997528565 5:134568697-134568719 GTCCCTCCTCGGCCCTGCCAGGG - Intronic
997624967 5:135325273-135325295 GCCCCTTGCAGGCCTGGCTAGGG + Intronic
998462714 5:142321390-142321412 GTCCCTTCCAGACCAAGCCAGGG - Intronic
999006651 5:147987335-147987357 CTCCCATTCAGGCTCTGCCATGG + Intergenic
999314509 5:150575266-150575288 GGCCCATCCTGGCCCTGCCATGG + Intergenic
1000037807 5:157461993-157462015 GGCCCTTCCAGGCACTGCCTGGG + Intronic
1000854751 5:166384122-166384144 ATCCCTTGCAGACCCTGAAATGG - Intergenic
1002082123 5:176743424-176743446 GTACCTTGCAGCTCCTTCCATGG - Intergenic
1002776797 6:335266-335288 GACCCTTGCTGACCCTGCCAGGG + Intronic
1003007830 6:2398127-2398149 GTGCATTGCAGGCCATGGCATGG - Intergenic
1003499725 6:6694499-6694521 CTCCATCGCAAGCCCTGCCACGG - Intergenic
1006434761 6:34020361-34020383 AACCCCTGCAGGCCCTGCCCTGG + Intronic
1006499418 6:34448449-34448471 GTCTCTTGCAGGCTCTCCCAGGG + Intergenic
1006838361 6:37012921-37012943 TGCTCTAGCAGGCCCTGCCATGG + Intronic
1007235645 6:40389922-40389944 GTCCCTTTCTGGTCCTGACAAGG - Intergenic
1007739521 6:44002294-44002316 GGCCCTTGGTGGCACTGCCACGG - Intronic
1010669882 6:78674847-78674869 GACCTTGGCAGGCACTGCCATGG + Intergenic
1012654985 6:101806113-101806135 CTCCATTGAAGGCACTGCCATGG - Intronic
1013414625 6:109913503-109913525 GTCCATTGCAGGCCCTGACCAGG + Intergenic
1016054850 6:139567569-139567591 GTGCCATGCAGCCACTGCCAGGG + Intergenic
1016614218 6:146028353-146028375 GTCCCTTGCAGGCCCTGCCAGGG + Intronic
1016614219 6:146028355-146028377 TTCCCTGGCAGGGCCTGCAAGGG - Intronic
1016686074 6:146883950-146883972 GTCAGTTGGAGGCTCTGCCAGGG - Intergenic
1017291727 6:152745180-152745202 GTCCCTGGCAGGCTCTTCCCAGG + Intergenic
1019146082 6:169976446-169976468 GTCCCTGGGAGGCCCTGCTGCGG + Intergenic
1019267980 7:129465-129487 GTCCCTTGCAACCCAGGCCAGGG - Intergenic
1019288999 7:240856-240878 GCCCCCTGCCAGCCCTGCCATGG - Intronic
1019388182 7:770460-770482 GTGTCTTACAGGCCCTGCCCTGG + Exonic
1019933058 7:4236270-4236292 GTCCCATTCAGGGCCTTCCATGG - Intronic
1020272461 7:6605538-6605560 GTCCCCTGCTGGTCCTGCCCTGG + Intronic
1022532664 7:31076719-31076741 GTCCCCTGCTGGGCCTGCCTTGG + Intronic
1023608753 7:41953838-41953860 GTCCTGTGCAGTCCCTGTCAGGG + Intergenic
1023792787 7:43766764-43766786 GTGACTGGCAGGACCTGCCATGG - Intronic
1024928459 7:54643267-54643289 GTCCCTGGAAGGCCCTTACAGGG - Intergenic
1026702091 7:72655720-72655742 GTACATTGGCGGCCCTGCCAGGG - Intronic
1027209699 7:76135638-76135660 GTCCCTTGCAGTTACTGACATGG + Intergenic
1029020182 7:97357021-97357043 GTACTTTGCATGCCCTGTCATGG - Intergenic
1029171180 7:98630065-98630087 GTGCCTGGCAGGCTCTGCCCAGG + Intergenic
1031815398 7:126427762-126427784 GTTCCTTGCAGCCCCTAGCAGGG + Intergenic
1031995784 7:128229941-128229963 GGGGCATGCAGGCCCTGCCAAGG + Intergenic
1032094202 7:128929528-128929550 GGCCCTTCCCAGCCCTGCCAGGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032388693 7:131541746-131541768 TTTCCCTGCAGGCCCTGGCAGGG - Intronic
1034284782 7:149877670-149877692 GCCCCTCTGAGGCCCTGCCATGG - Intronic
1034530924 7:151696098-151696120 CTCCTCTGCAGCCCCTGCCAGGG + Intronic
1038455404 8:27669409-27669431 GTTCCCTGCAGGTCCTGCCAGGG + Intronic
1045486640 8:102636672-102636694 TTCCCTCGCCTGCCCTGCCATGG + Intergenic
1045942576 8:107755794-107755816 CCCCCTTGCAGGCCGTGCTATGG - Intergenic
1048034701 8:130666391-130666413 CTCCCTGACAGTCCCTGCCAAGG + Intergenic
1048327102 8:133448338-133448360 GTCCCCTGGAGTCCCTGCCGAGG + Intergenic
1048327121 8:133448404-133448426 GTCCCCTGGAGTCCCTGCCGAGG + Intergenic
1049213558 8:141397587-141397609 GTCCCCTGCAGACCCTCACAAGG + Intronic
1049253491 8:141601788-141601810 GTCACTCCCAGGCACTGCCATGG - Intergenic
1049909846 9:255014-255036 TTCCCTTGCAGGCCCTGTTCTGG - Intronic
1051429108 9:16964038-16964060 TTCCCTTCCTGGCCCTGCCTTGG + Intergenic
1052316468 9:27120793-27120815 GGCCCTTGCAGGAGCAGCCAGGG + Intronic
1053035895 9:34826520-34826542 GTCCCTTGCCCTCCCTGCCTGGG + Intergenic
1053135909 9:35650183-35650205 AACTCTTGGAGGCCCTGCCAGGG - Exonic
1056824446 9:89866819-89866841 TTCCCTTGCAGGCCTTGCTGAGG + Intergenic
1057274819 9:93670596-93670618 CTCCCTGCCAGGCCCTCCCATGG - Intronic
1057294728 9:93828345-93828367 GCCCCTGGCAGGCCTTGGCAGGG + Intergenic
1057879823 9:98784738-98784760 GTCCTTTGCAGGGCCACCCAGGG - Intronic
1059433304 9:114262513-114262535 ATCCCTGCCAGGCTCTGCCAGGG - Intronic
1059665574 9:116443368-116443390 GAACCTTGTAGGCCATGCCAGGG + Intronic
1060152110 9:121295516-121295538 GTGTCTTCCAGGCCCAGCCAAGG + Intronic
1060221865 9:121768377-121768399 GGCCCAGGCAGGCCCTGCCCAGG - Intronic
1061162492 9:128903201-128903223 CTCCCCTGCAGGCCCTCCTAGGG - Intronic
1061285020 9:129617463-129617485 GTCCCCTGCAGGGCCTACCAGGG + Intronic
1062227790 9:135463272-135463294 GTCCCCTGCAGGGACTTCCAAGG - Intergenic
1062598978 9:137311671-137311693 GGCCCTGGGAGGCCCTGCCCCGG + Intronic
1062707612 9:137954039-137954061 ATACCGTGCAGGCCCTGCCTTGG - Intronic
1203431512 Un_GL000195v1:94672-94694 GTCCATGGCAGGCTCTGCCTGGG + Intergenic
1203360573 Un_KI270442v1:217168-217190 TTCCCTTGCATGGCCTGCCGGGG - Intergenic
1203365619 Un_KI270442v1:252391-252413 GTCCCTTGTAAGCCATGCAAAGG - Intergenic
1186981404 X:14961309-14961331 GTACCATGAAGGGCCTGCCAAGG - Intergenic
1187365247 X:18661273-18661295 CTCCCTTGCATGCCCTGAGATGG - Intronic
1190100285 X:47517756-47517778 GTCACTTCCAGGCACTGCCTAGG + Intergenic
1192144532 X:68672723-68672745 GCCCCTTGGCTGCCCTGCCATGG - Intronic
1192154394 X:68733073-68733095 CCCCCTTGTGGGCCCTGCCAGGG - Intergenic
1192412381 X:70945486-70945508 GTCTCATGCAGGGCCAGCCAGGG - Intergenic
1194565552 X:95483781-95483803 GTCTCTTCCAGGCCCTCCAATGG - Intergenic
1196031582 X:111098950-111098972 GTCCATTCCAGGCCCTGCAGAGG - Intronic
1197062280 X:122195701-122195723 GACCTTGGCAGGCACTGCCATGG - Intergenic
1199460088 X:148074703-148074725 GTGCCCAGCAGGCCCTGCCAAGG - Intergenic
1200135698 X:153873587-153873609 GGCCCTGCCAGGCCCTGCCAGGG - Intronic
1200243208 X:154508406-154508428 CTCCCTTGCAGACCCGGCCCTGG + Intronic
1201073076 Y:10167836-10167858 GTCCCTTGTAAGCCATGCAAAGG + Intergenic
1201077865 Y:10200368-10200390 GTCCCCAGTGGGCCCTGCCATGG - Intergenic
1202092933 Y:21213039-21213061 GACCTTGGCAGGCACTGCCATGG - Intergenic