ID: 1016615356

View in Genome Browser
Species Human (GRCh38)
Location 6:146041622-146041644
Sequence GTTCAGCAGCACCACATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 4, 1: 11, 2: 26, 3: 43, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016615356_1016615357 -7 Left 1016615356 6:146041622-146041644 CCTACAATGTGGTGCTGCTGAAC 0: 4
1: 11
2: 26
3: 43
4: 151
Right 1016615357 6:146041638-146041660 GCTGAACCTCCTCTCTGACTCGG 0: 1
1: 0
2: 0
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016615356 Original CRISPR GTTCAGCAGCACCACATTGT AGG (reversed) Intronic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
909035963 1:70594082-70594104 GTACTTCAGCACTACATTGTAGG + Intergenic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
914671966 1:149877677-149877699 GTTCAGCAGCTCCTCCTTGCAGG - Intronic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
915966735 1:160315417-160315439 GCTCAGCAGCACTGCATTGCAGG + Intronic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
916799199 1:168199343-168199365 GTACAGAATCACCACATTTTCGG - Intronic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
921668109 1:217896668-217896690 TTTCAGCAGAGCCACATTGCAGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1065823717 10:29550821-29550843 GTTCAGCAGCACCTCCGGGTCGG + Exonic
1065863026 10:29887299-29887321 GTTCTACAGCACTACATAGTGGG + Intergenic
1069759039 10:70795293-70795315 GTTCTGCAGAACCCCCTTGTTGG + Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1069914263 10:71777744-71777766 ATCCAGCAGCACCTCATAGTGGG - Intronic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072434367 10:95401934-95401956 GTTCAGCAGAGCCACATTAAGGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073595180 10:104792393-104792415 ATTCTTCAGAACCACATTGTTGG + Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077845939 11:6025026-6025048 GATCAACTGCCCCACATTGTGGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081644688 11:44781496-44781518 GTGCAGTAGCAGCACATAGTAGG + Intronic
1087208109 11:95418168-95418190 CTTCATCAGTCCCACATTGTGGG + Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1089797090 11:120989573-120989595 TTTCAGCAACACCAGATTGGTGG + Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1091951505 12:4596657-4596679 CTTCATATGCACCACATTGTAGG - Exonic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093763841 12:22939989-22940011 GTGCAGCAGCAGCACAATCTTGG + Intergenic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1102371287 12:112383975-112383997 GTTAACCAGCCCCATATTGTTGG - Intergenic
1102650465 12:114438754-114438776 GTTCAATTGCACCACATTCTGGG + Intergenic
1103377736 12:120469704-120469726 GCTCAGCCGCACTGCATTGTGGG + Exonic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1104108910 12:125688005-125688027 GTACAACAGCTCCACATTGCTGG - Intergenic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1104354647 12:128074785-128074807 TTTCAGCAGCTCTACATTTTGGG + Intergenic
1104607803 12:130202840-130202862 GATCAGCAGCAACACAAAGTGGG - Intergenic
1104608308 12:130205834-130205856 GATCAGCAGCAACACAAAGTGGG + Intergenic
1106192532 13:27466306-27466328 CTTCAGCAGGACCACAGTGGAGG + Intergenic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108364115 13:49692944-49692966 GTTCATCTGCACCTCATTATTGG + Intergenic
1108666938 13:52642159-52642181 GATCACCAACCCCACATTGTTGG - Exonic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109278550 13:60329651-60329673 GATCAGCAGCTCCAGATTTTAGG + Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1113439160 13:110314560-110314582 TTTCTGCAGCACCACATGGGAGG + Intronic
1113694632 13:112335577-112335599 GCTCACCTGCACCACATTGGAGG - Intergenic
1114935886 14:27535677-27535699 GTGCAGCAGCACCCCATTTTTGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116825512 14:49669819-49669841 GTATGGCAGCAGCACATTGTAGG + Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1120394069 14:83945148-83945170 CTTCAGCAGCACCCCATTCCTGG + Intergenic
1124237277 15:28001765-28001787 GTCCTCCAGCACCACATTCTGGG - Intronic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1131944103 15:97600203-97600225 ACTCAGCATCACCATATTGTGGG - Intergenic
1137237377 16:46626656-46626678 GATCAGCAGCTGCACAATGTTGG + Intergenic
1137821222 16:51447940-51447962 GTTGAGCAGCACAAAATTCTAGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139551538 16:67675752-67675774 GGTCAGCAGGTCCACAATGTAGG + Exonic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150289441 17:63973024-63973046 GTGCAGCAGCAGCACCTTGCAGG - Intergenic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155037928 18:22041048-22041070 GATCAGGAGTACCACATTTTAGG + Intergenic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156509942 18:37627893-37627915 GGTGAGCAGCACCACAGAGTGGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1158999596 18:62960687-62960709 CTTCAGCAGCACCAATTTGAGGG - Intronic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1164954102 19:32366331-32366353 CTTCAGCAGCACCCCTTCGTGGG + Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1165819664 19:38666388-38666410 GTTCAGGAGCTGCCCATTGTTGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926816817 2:16805673-16805695 TTTCAGCAGCACCCCATTTCTGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
928600130 2:32896434-32896456 CTTCAGCAGCTCCAGATTCTAGG - Intergenic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
934330858 2:92066843-92066865 ATTCAGCAGCACCACATCTCAGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
947818973 2:233057668-233057690 GCTCAGCATCACCACATGGATGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
948881639 2:240860781-240860803 GTTCTGCAGGACCCCCTTGTTGG - Intergenic
1170432993 20:16294416-16294438 GCTCAGCAACACCCCTTTGTTGG - Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1172382881 20:34511591-34511613 GTTCATCTGCACCTCATTATTGG - Intergenic
1176220251 20:63966194-63966216 GGTCAGCAGCACCATTTTGCAGG + Exonic
1178824328 21:36002989-36003011 GTTTAGCAGCAGCAGATTTTTGG - Intronic
1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG + Intergenic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1181904864 22:26186377-26186399 ATTCAGGACCACCACATTGATGG + Intronic
1181976007 22:26730409-26730431 GATCAGAACCACTACATTGTGGG + Intergenic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954457809 3:50609467-50609489 GTTCAGTAACACCATATTCTTGG + Intronic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
961751023 3:129094987-129095009 GATCAGCAGCTGCACAATGTTGG + Exonic
962247860 3:133812289-133812311 GTTCATCACCACCATCTTGTGGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
964537124 3:157735175-157735197 GTTCAGCAGCTTCACACAGTAGG + Intergenic
965279758 3:166734776-166734798 GTTAAGCAGCATCACAAGGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
968134474 3:196211199-196211221 GACCAGCAGCACCACATTGAAGG + Exonic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
968407269 4:351759-351781 GTTCACCAGCAACACATTACGGG - Intronic
968854587 4:3110010-3110032 CTTCAGCAGCACCAGCTTCTTGG + Intronic
969232242 4:5839852-5839874 GCCCAGCTCCACCACATTGTCGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
977872233 4:102105854-102105876 GTTGAGAAGCACCACATCTTAGG + Intergenic
978969068 4:114780532-114780554 GTTCAATAGCACCACACTATAGG - Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980173416 4:129316352-129316374 GTGTAGTAGCACCTCATTGTGGG + Intergenic
980728088 4:136790576-136790598 GTTCAGCAGCACAATATTTCTGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984181561 4:176489477-176489499 TGTCAGCAGGACCACATTCTAGG + Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
985461262 4:190108964-190108986 GGTCAGCAGCTCCACTTTCTTGG + Intergenic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
987379522 5:17272013-17272035 GTGCAGCAGCAGCACAATCTCGG - Intronic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999969765 5:156847612-156847634 ATTCAGCAGCAGTACATTGTAGG + Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1013687977 6:112608472-112608494 TTTCAGCAGCACTCCATTGCTGG - Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014327703 6:120019211-120019233 TTTCAGCAGCACCACATTTCTGG + Intergenic
1014961547 6:127692340-127692362 TATCAACAGCACCACATCGTAGG - Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019079095 6:169416935-169416957 TTACAGCAGCATCACATTATGGG - Intergenic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1031024384 7:116664148-116664170 GATCACCAGCAGCTCATTGTAGG + Intergenic
1031365365 7:120894799-120894821 TTTCAGCAGCACCCCATTCTCGG - Intergenic
1033134518 7:138773576-138773598 GGTCAACAGCACCACAAAGTGGG + Intronic
1034594605 7:152177789-152177811 GTTCAGCAGCACAACATACTGGG - Exonic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1038347231 8:26743532-26743554 GTTTAGCAGCACCAGGTGGTTGG - Intergenic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1050417103 9:5429327-5429349 GTGCAGCAGCACCACCTGCTTGG + Intronic
1050580705 9:7052769-7052791 GTGCAGCAGCACCACCTCGTGGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053724100 9:40978728-40978750 GTTTATGGGCACCACATTGTGGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1056034029 9:82584904-82584926 GTGCAGCAACCCCACAATGTAGG + Intergenic
1056568999 9:87799511-87799533 GCTCAGCAGCTCCACAGTGCAGG - Intergenic
1056733605 9:89185810-89185832 GATCAGCCTCACCACAGTGTTGG + Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060438053 9:123612887-123612909 GCACAGCAGCAGCACATGGTAGG + Intronic
1060943992 9:127559282-127559304 GTGCAGCACCTCCACATTGCAGG - Intronic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187691967 X:21877647-21877669 GTTTACCAGCACCACAGTGCAGG + Intronic
1187819837 X:23275648-23275670 GTTCAGCAGCATCAGCATGTTGG - Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1198636685 X:138710121-138710143 GTTCAAAAGCACCACAGTCTGGG + Intronic
1199200787 X:145086979-145087001 TTACAACAGCACCACATTTTTGG - Intergenic
1200075580 X:153549078-153549100 GTTCAGCATCTGCACAATGTGGG + Intronic