ID: 1016615356

View in Genome Browser
Species Human (GRCh38)
Location 6:146041622-146041644
Sequence GTTCAGCAGCACCACATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016615356_1016615357 -7 Left 1016615356 6:146041622-146041644 CCTACAATGTGGTGCTGCTGAAC No data
Right 1016615357 6:146041638-146041660 GCTGAACCTCCTCTCTGACTCGG 0: 1
1: 0
2: 0
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016615356 Original CRISPR GTTCAGCAGCACCACATTGT AGG (reversed) Intronic