ID: 1016615357

View in Genome Browser
Species Human (GRCh38)
Location 6:146041638-146041660
Sequence GCTGAACCTCCTCTCTGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016615353_1016615357 16 Left 1016615353 6:146041599-146041621 CCAGAAGACTCATGAATGTGCCT 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1016615357 6:146041638-146041660 GCTGAACCTCCTCTCTGACTCGG 0: 1
1: 0
2: 0
3: 22
4: 184
1016615356_1016615357 -7 Left 1016615356 6:146041622-146041644 CCTACAATGTGGTGCTGCTGAAC No data
Right 1016615357 6:146041638-146041660 GCTGAACCTCCTCTCTGACTCGG 0: 1
1: 0
2: 0
3: 22
4: 184
1016615355_1016615357 -4 Left 1016615355 6:146041619-146041641 CCTCCTACAATGTGGTGCTGCTG No data
Right 1016615357 6:146041638-146041660 GCTGAACCTCCTCTCTGACTCGG 0: 1
1: 0
2: 0
3: 22
4: 184
1016615352_1016615357 17 Left 1016615352 6:146041598-146041620 CCCAGAAGACTCATGAATGTGCC No data
Right 1016615357 6:146041638-146041660 GCTGAACCTCCTCTCTGACTCGG 0: 1
1: 0
2: 0
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016615357 Original CRISPR GCTGAACCTCCTCTCTGACT CGG Intronic