ID: 1016622169

View in Genome Browser
Species Human (GRCh38)
Location 6:146123613-146123635
Sequence CTGGAGGCACAGTTGGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016622169_1016622177 22 Left 1016622169 6:146123613-146123635 CCAATACCCAACTGTGCCTCCAG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1016622177 6:146123658-146123680 TGTTCTTCATGAATTCTGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 257
1016622169_1016622174 -1 Left 1016622169 6:146123613-146123635 CCAATACCCAACTGTGCCTCCAG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1016622174 6:146123635-146123657 GTCCCTGCTGTCTTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016622169 Original CRISPR CTGGAGGCACAGTTGGGTAT TGG (reversed) Intronic
901157555 1:7150587-7150609 CTGGAGACACACTTGGTTGTCGG - Intronic
901229342 1:7633323-7633345 CAGGAGGCACAGCTGGGTTAAGG + Intronic
903047314 1:20574589-20574611 CTGCAGGCACAGTGGGGCATGGG + Intergenic
903213696 1:21831854-21831876 CTAGGGGCCCAGTTGGGTAGAGG + Intronic
903332256 1:22602187-22602209 CTGGAGGCACATGTGGGTGATGG + Exonic
906409601 1:45568064-45568086 CTGGAGGCACTGGTGGCTAAGGG + Exonic
907288643 1:53398207-53398229 CTGGAGGCATAGTTAGGCAGTGG - Intergenic
907557799 1:55359832-55359854 TTGGAGGCACAGTCAGCTATAGG + Intergenic
910391201 1:86746447-86746469 CTTGAGGCAAAGTTGGCTATAGG - Intronic
912754321 1:112311871-112311893 ATGGAGGCACTGTTTGGTTTTGG - Intergenic
912869492 1:113291093-113291115 CTGCATGCACAGGGGGGTATGGG - Intergenic
914247271 1:145895657-145895679 CTGGATGCACAGGTGGGCCTGGG + Exonic
915631155 1:157154945-157154967 CTGCAGGCAGAGGTGGGTAGGGG - Intergenic
916406330 1:164501023-164501045 CTGGAGGAACAGGTGGCTGTGGG + Intergenic
918999958 1:191818034-191818056 CTGAAGTCACAGTTGAGAATGGG + Intergenic
922916125 1:229259212-229259234 CTGTAGGAATTGTTGGGTATTGG - Intergenic
1063386866 10:5621280-5621302 CTGGAGGGACAGTTGAGTCTGGG - Intergenic
1066430669 10:35348464-35348486 CTGCAGGCACACTTGGCTGTTGG + Intronic
1069832809 10:71291445-71291467 CAGGAGGCACAGAGGGGTGTAGG - Exonic
1070753657 10:78978264-78978286 CTGGAGGCTCAGTGGGGCACTGG - Intergenic
1074556810 10:114499044-114499066 CTGGAAGCACTGGTGGGTTTGGG - Intronic
1075489993 10:122858595-122858617 CTGTGGGCACAGGTGTGTATGGG - Intronic
1077105775 11:842083-842105 CTGGGGGCAGAGATGGGAATAGG + Intronic
1078139884 11:8684234-8684256 CTAGAGTCACGCTTGGGTATCGG + Intronic
1078141752 11:8698265-8698287 CAGGAGGCACAGTTGGCTTGGGG + Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1085473633 11:76774082-76774104 CTGGAAGCAAAGCTGGGTAAGGG + Intergenic
1087085937 11:94219031-94219053 TTGGAGGCAAAGCTGGGTCTAGG + Intergenic
1088693041 11:112344052-112344074 CTGGAGGCACAGTGGGGGTGGGG + Intergenic
1090213957 11:124943875-124943897 CAGGAAGCACAGTTGAGTCTAGG - Intergenic
1090864804 11:130690209-130690231 CTGGAGTCCCAGTTGGAAATGGG + Intronic
1091149825 11:133317811-133317833 CTGGTGGTACACTTAGGTATAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1103942661 12:124509396-124509418 CTTCAGGCACAGTTGGGTCCAGG - Intronic
1104894570 12:132155565-132155587 CAGGAGGTAGAGTTGGGTGTTGG + Intergenic
1106372932 13:29154040-29154062 ATGGAGGCACACTTGGCTGTTGG + Intronic
1107906834 13:45069109-45069131 GTGGAGGTACACTTGGGTCTCGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112875965 13:104039240-104039262 CTGGAGGAACAATTGGTTGTTGG - Intergenic
1119036923 14:71238059-71238081 CTGGGGGCAGAGTTGGGTGGGGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122059732 14:99128993-99129015 CTGGAGGCTCAGGTGGGTGAAGG + Intergenic
1122574514 14:102733192-102733214 TTGGAGGCACGGATGGGCATGGG - Intergenic
1127345706 15:58095726-58095748 CTGGAGCCACAGGTGTGTACTGG + Intronic
1127870303 15:63067536-63067558 CTGGAGGCACATCTGTGTTTTGG + Intronic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1128429031 15:67573381-67573403 CAGGAGAGACAGTTGGGTAGAGG + Intronic
1128944307 15:71810874-71810896 CTGGAGGTAGGGTTGGGTCTGGG + Intronic
1129356573 15:74995900-74995922 CGGGAGCCACAGATGGGAATGGG - Intronic
1130854216 15:87826643-87826665 CTGATGGCACAGTTGAGCATGGG + Intergenic
1131944438 15:97604230-97604252 ATGCAGCCAAAGTTGGGTATGGG + Intergenic
1131985832 15:98042184-98042206 CAGGAAGGACAGATGGGTATGGG - Intergenic
1134810911 16:17166346-17166368 CTGGAGGAACAGATGGGAATTGG - Intronic
1136991421 16:35153392-35153414 CTGGAAGCACAGTGGGGTCAAGG + Intergenic
1137404572 16:48179415-48179437 CTGGAGGCAGAGCTGGGCTTGGG + Intronic
1138100286 16:54246699-54246721 CTGGAGGCAGAGTGGGCCATGGG + Intronic
1138339148 16:56277252-56277274 CTGGAGGCCAAGTTGGGAAGTGG + Intronic
1141602247 16:85133911-85133933 CTGGAGGGACAGGTGAGTTTAGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1146164642 17:30578267-30578289 CTGGAGGCAGACATGGGTGTAGG - Intergenic
1147917618 17:43898198-43898220 GGGGAGGCACAGTAGGGGATGGG - Intronic
1151041274 17:70863207-70863229 ATGGAGGCATAGATGGGTAGAGG + Intergenic
1151084840 17:71368136-71368158 CTGCAGGCACAATTGAGTACAGG - Intergenic
1151440557 17:74126234-74126256 CTGGAGGCACGGCTGTGTTTTGG - Intergenic
1153059578 18:981458-981480 CTTGAGGCACTTTTGGGTAGAGG + Intergenic
1158629297 18:59098388-59098410 CTGGAGGCTGAGAAGGGTATGGG + Intergenic
1160010809 18:75105984-75106006 CTAGAGTCCCAGTTGGGGATAGG - Intergenic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1164685548 19:30164221-30164243 CTGAAGGCTCAGTTGAGTGTTGG - Intergenic
1165048594 19:33126374-33126396 CTGGAGGCGCAGCTGGGTCAGGG + Intronic
1165114439 19:33520786-33520808 CTGGTGGTACAGTGGGGTAGAGG - Intronic
1165447247 19:35863053-35863075 CTGGAGGCACAGTCAGGTCTGGG - Intronic
1165473598 19:36017103-36017125 CAAGAGGCCCAGATGGGTATTGG - Intronic
926226737 2:10972109-10972131 CTGATGGCACATTTGGCTATAGG + Intergenic
927442620 2:23129976-23129998 CCTTGGGCACAGTTGGGTATAGG - Intergenic
927492692 2:23531074-23531096 CTGGATGCACAGTGAGGTAGAGG + Intronic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
928431204 2:31219672-31219694 CTGGTGGCACAGTGGAGTATTGG + Intronic
930578687 2:53183785-53183807 CTTGAGGAACAGCTGGGAATGGG - Intergenic
932702167 2:73999633-73999655 CTGGGAGCACAGTAGGGTCTGGG + Intronic
934689948 2:96350846-96350868 CAGGAGATACGGTTGGGTATGGG - Intronic
937643682 2:124242227-124242249 CTGGAGCCACTGTTGAGCATTGG - Exonic
938341539 2:130539602-130539624 CTGGAGACACAGTGGAGCATGGG + Exonic
938348291 2:130581107-130581129 CTGGAGACACAGTGGAGCATGGG - Intronic
939334562 2:140808999-140809021 CTAGTGGTACAGTTGGGTGTTGG + Intronic
944668315 2:201974752-201974774 CTGCAGGGACATTTGGGAATTGG - Intergenic
944938620 2:204597088-204597110 CTGGCTGCAGAATTGGGTATGGG + Intronic
945713062 2:213324235-213324257 CTTGAGGTACAGTAGGGAATGGG - Intronic
948414472 2:237792458-237792480 CTGGAGGCAGGCTTGGGAATAGG - Intronic
1173353078 20:42262621-42262643 CTGGAGGCAGAAGTGGGGATGGG + Intronic
1175221993 20:57422508-57422530 CTAAAGGCACAGTGGGGGATGGG + Intergenic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1176409148 21:6438334-6438356 CTGAAGGCACAGGTGGGCAAAGG - Intergenic
1179482164 21:41685360-41685382 CTGAAGGCAGAGCTGGGTGTGGG - Intergenic
1179680913 21:43020777-43020799 CAGGAGGCACAGGTGGGAACAGG + Intronic
1184074153 22:42165431-42165453 CAGGAGGAAGAGCTGGGTATAGG + Intronic
1184074848 22:42169727-42169749 CCGGAGGCACAGGTGGGGACAGG + Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
951844677 3:27072726-27072748 CTGGAGGCGCAGTTGTTTTTTGG + Intergenic
952994436 3:38865099-38865121 CTGGTGGCAGAGTTGAGTAAGGG + Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953502116 3:43446929-43446951 CAGGAGGCACAGTGGGGCATTGG - Intronic
953787397 3:45921443-45921465 CTGGGAGCACAGTTGGCTACAGG - Exonic
954689970 3:52390555-52390577 CAGGAGGGTCAGTGGGGTATGGG + Intronic
955827367 3:62962490-62962512 CTGGAGGCACTGTGGGCTCTTGG + Intergenic
956297016 3:67726015-67726037 CTTGAGGCACAGGTGGATCTAGG + Intergenic
957152024 3:76498291-76498313 CTGGGGGCGCAGTAGGGTGTGGG + Intronic
957649176 3:82977304-82977326 TTGAAGGCACACTTGGGTGTTGG - Intergenic
960683638 3:120274803-120274825 CTGGAGGCACTGTTGATTCTGGG - Intronic
961096355 3:124159857-124159879 CTAGAGGTACTGATGGGTATGGG + Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
964541063 3:157780559-157780581 TTGGAGGCACAGGTGGTTTTTGG - Intergenic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
967663272 3:192138987-192139009 CTAGAGGCTCAGTTGAGTTTAGG - Intergenic
968210687 3:196846309-196846331 CTGGAGGCACAGTCTGCCATAGG - Intergenic
969210474 4:5683527-5683549 CTGGAGACACAGTTGTGAATAGG + Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
972366004 4:38375063-38375085 CTGGAGGTTCAGTTGGGGAAAGG - Intergenic
972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG + Intronic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
976067662 4:81207616-81207638 CTTGAAGCACAGTTAGGTAGAGG + Intronic
976533261 4:86180836-86180858 CTGGAGGCTGAGATGGGTAAGGG + Intronic
976987988 4:91326847-91326869 ATGGAGGCACTGCTGGGTTTTGG - Intronic
980126226 4:128776870-128776892 CTGGAGCCAGGGTTGGGCATGGG + Intergenic
981801957 4:148668044-148668066 CTGGAGGCTCATTTGGAGATGGG - Intergenic
983528334 4:168783737-168783759 CTGGAGGTAGAGGTGGGGATTGG + Intronic
984850359 4:184147239-184147261 TTGGAGGCACACTTAGGAATTGG - Intronic
985200999 4:187485488-187485510 CTGTTGGCACAGGTGGATATAGG + Intergenic
985555387 5:555525-555547 CTGGGGGCAGAGTTGGGCAGCGG - Intergenic
986774912 5:11005515-11005537 TGGGAGACATAGTTGGGTATGGG + Intronic
990508548 5:56468947-56468969 CTGGAGTGAGAGTTGGGAATGGG - Intronic
995740178 5:115347809-115347831 CAGGAGGAACAGTTGGATTTGGG + Intergenic
997891616 5:137682036-137682058 CTGGGGGTACAGTTGGGTCTCGG + Intronic
998574733 5:143302022-143302044 TTGGAGGCACAGTATGATATAGG + Intronic
998959541 5:147470178-147470200 ATGGAGGCAGAATTGGGTAGAGG - Intronic
999233078 5:150073720-150073742 ATGGAGGCACAAATGGGGATAGG - Intronic
999254049 5:150199757-150199779 CTTCAGGCACAGCTGGGTCTAGG + Intronic
999845665 5:155476661-155476683 CTGCAGGCACAGTTGGTAAAAGG + Intergenic
1001018537 5:168163252-168163274 TTGGAGCCACAGCTGGGTTTGGG - Intronic
1004442722 6:15669470-15669492 CTCCAGGCACAGTTGGTTCTTGG - Intergenic
1006367089 6:33622012-33622034 CTGGAGGCTGAGTTGGGGAAGGG + Intronic
1006402318 6:33825015-33825037 CTGCAGGCACTGCTGGGTTTGGG + Intergenic
1006603826 6:35242787-35242809 CTGGGGGCACTGTTGGGAAGAGG + Intronic
1007211170 6:40194433-40194455 ATGGAAGCACAGTTGGGCAGAGG + Intergenic
1010147823 6:72692616-72692638 CTGTAGGCACAGCTAGGAATGGG + Intronic
1011183232 6:84645112-84645134 CTGGAGGGACTGCTTGGTATAGG + Intergenic
1012886076 6:104847707-104847729 CTAGAAGCACAGTTGAGAATAGG + Intronic
1015852050 6:137584305-137584327 CTGGGGGCACAGTTAAGGATGGG - Intergenic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1016962054 6:149683372-149683394 ATGGAGGAACAGATGGGTTTTGG + Exonic
1017045365 6:150342244-150342266 CAGAAGGCACAGTTGGGTCAGGG + Intergenic
1019106500 6:169671857-169671879 CTGGAGACACAGTGGTGAATAGG - Intronic
1019690217 7:2406368-2406390 GTGGGGGCACAGTTGAGTATGGG + Intronic
1019690224 7:2406391-2406413 GTGGGGGCACAGTTGAGTACGGG + Intronic
1019690231 7:2406414-2406436 GTGGGGGAACAGTTGAGTATGGG + Intronic
1019690238 7:2406437-2406459 GTGGGGGCACAGTTGAGTACGGG + Intronic
1019690245 7:2406460-2406482 GTGGGGGCACAGTTGAGTACGGG + Intronic
1019690252 7:2406483-2406505 GTGGGGGCACAGTTGAGTACGGG + Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1027425039 7:78053676-78053698 ATGGACTCACAGTTGGGGATTGG - Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1028724229 7:94069437-94069459 CAGGAGGCACAGGTGGCTTTTGG + Intergenic
1029543320 7:101197501-101197523 CTTGAGACACAGTTGTGTAGTGG + Intronic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1034279736 7:149844721-149844743 CTGGTGGCACCACTGGGTATGGG + Exonic
1034439061 7:151077322-151077344 CTGGAGGCACAGTCAGGTCCTGG + Exonic
1037105545 8:15102613-15102635 ATGGAGGGACAGCAGGGTATAGG + Intronic
1037491001 8:19397125-19397147 CTGTAGGCACAGGGGGGTATTGG - Intergenic
1037818422 8:22124075-22124097 CTGGGGGCAGAGCTGGGTGTGGG - Intronic
1039718562 8:40137460-40137482 CTAGTGGCACTGTTGGGTATGGG - Intergenic
1043039575 8:75244373-75244395 CTGGAGGCAGTGTTTGCTATTGG + Intergenic
1045378231 8:101597323-101597345 CTGGAGCCACAGTTAGAAATAGG + Intronic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1046059410 8:109118784-109118806 CTTGAGCCAGAGTTGGCTATAGG + Intronic
1047663293 8:127062033-127062055 GTGGAGGCAGAGTTGGGTTAAGG + Intergenic
1049421264 8:142517639-142517661 GTGGAGGGACAGGTGGGTGTGGG + Intronic
1049806693 8:144544237-144544259 CTGGGGACAGTGTTGGGTATAGG - Intronic
1049917701 9:334462-334484 CTGGGGGCACAGTGAGGTGTGGG + Intronic
1049989872 9:980860-980882 CTGGAGGAAAAGTTGGGGGTAGG - Intronic
1052185366 9:25587487-25587509 CAGGAGGCCTAGTTGGGGATTGG + Intergenic
1053168516 9:35861595-35861617 CAGGAGGCAAAGCTGGGTTTTGG - Intergenic
1055868714 9:80847563-80847585 GTGGAGGGGCAGTTGGCTATAGG - Intergenic
1056405922 9:86275036-86275058 CTGGAGGCACAGCTAGGAAGTGG - Intronic
1057733125 9:97629198-97629220 CTGTAGGCAGAGTTGTGAATTGG - Intronic
1058701944 9:107608235-107608257 CTGGAGGCACAGCTATGAATGGG + Intergenic
1058931934 9:109729238-109729260 CTGGAGGCTCAGGTGGCCATGGG - Intronic
1059325498 9:113501744-113501766 CTGCAGGCTCACTTGGATATGGG + Intronic
1059959226 9:119548995-119549017 CTGGAGCCTCAGTTGGGAAGAGG - Intergenic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1186617073 X:11200507-11200529 CTGAAGACACTGTTTGGTATTGG - Intronic
1189877985 X:45456632-45456654 CTGAAGGCACAAATGGGGATAGG - Intergenic
1190550285 X:51572517-51572539 CTTGGGCCACAGATGGGTATGGG - Intergenic
1191783661 X:64894692-64894714 CTGGAGTCAGAGTTGGGAGTAGG + Intergenic
1191915888 X:66200775-66200797 CTAGAGGCTTTGTTGGGTATAGG + Intronic
1194589661 X:95783995-95784017 CTTGAGGCACAGAAAGGTATGGG + Intergenic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1197614453 X:128675782-128675804 CTGAAGGCACAGTTTGGAAAGGG - Intergenic