ID: 1016623441

View in Genome Browser
Species Human (GRCh38)
Location 6:146139389-146139411
Sequence TGTCCAATGCTGAAAGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016623441 Original CRISPR TGTCCAATGCTGAAAGTACA GGG Intronic
902846153 1:19112110-19112132 TGTCCAAGGCGTATAGTACAAGG + Intronic
907860013 1:58343823-58343845 TGTCAAGTGCTGTAAATACATGG + Intronic
908518717 1:64919694-64919716 TGGCAAATGATGAAAGTCCAGGG - Intronic
911552818 1:99305133-99305155 TGTACAATGCTGAACACACAAGG + Intronic
911591770 1:99755913-99755935 TGTCAAATGCTGACTGTTCAAGG + Intronic
911783386 1:101912260-101912282 TGTGCAAAGCTGAAAGTGCAAGG + Intronic
912373765 1:109193596-109193618 TCTCAGATGCAGAAAGTACATGG - Intronic
912535570 1:110367186-110367208 TCTCTACTGCTGAAAGTAAAAGG + Intronic
913145384 1:115984443-115984465 TATCCAAAGCTGTAAATACAAGG - Intronic
913264464 1:117030984-117031006 TGCCCAATGCTCAAAGTACAAGG - Intronic
913648812 1:120889805-120889827 TGACCATGGCTGATAGTACAGGG - Intergenic
914077882 1:144373578-144373600 TGACCATGGCTGATAGTACAGGG + Exonic
914101297 1:144592927-144592949 TGACCATGGCTGATAGTACAGGG - Exonic
914172791 1:145242118-145242140 TGACCATGGCTGATAGTACAGGG + Exonic
914297680 1:146344709-146344731 TGACCATGGCTGATAGTACAGGG + Intergenic
914527447 1:148483246-148483268 TGACCATGGCTGATAGTACAGGG + Exonic
914638947 1:149583882-149583904 TGACCATGGCTGATAGTACAGGG - Exonic
916184311 1:162115967-162115989 TGTCAAATACTCAAAGTAGAAGG + Intronic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
920447799 1:206032842-206032864 TGTGAAATGCTGCAAGTTCAAGG + Intergenic
921168745 1:212526802-212526824 TGTACAAAGCTGATTGTACATGG + Intergenic
923106360 1:230856941-230856963 TGTCAAAAGCTGAAAGAAGAGGG - Intronic
923798186 1:237180318-237180340 TGTCCACAGCTGAAAGGAGAGGG - Intronic
1066111336 10:32199774-32199796 TGCCCCATGCAAAAAGTACAAGG - Intergenic
1066972877 10:42331589-42331611 TGTCCCAAGCTCAAAGTAAAAGG - Intergenic
1069403170 10:68070942-68070964 TGTCCTAGGCTCAAAGTGCATGG + Intronic
1069463661 10:68618482-68618504 AGCCCAATGCTGAAAGTCAATGG + Intronic
1070463488 10:76693160-76693182 TGTGCAATGGTAAAAGGACAAGG + Intergenic
1071782178 10:88858399-88858421 TAACTAATGCTGCAAGTACATGG - Intergenic
1073165164 10:101441404-101441426 GGTCCAATGCTGAAATTCTATGG - Intronic
1075345140 10:121676441-121676463 TGTCGAATGCTGGAAGCCCAGGG + Intergenic
1076774786 10:132689177-132689199 TGTCCTCAGCTGAAAGCACAGGG - Intronic
1082845077 11:57718524-57718546 TGACCATGGCTGATAGTACAGGG + Intronic
1085987422 11:81803861-81803883 TATCCAATATTGAAAGAACAGGG - Intergenic
1087974659 11:104530172-104530194 TGTCCAATAGTAAAAGTAAATGG + Intergenic
1090418598 11:126558044-126558066 ATTGCAATGCTGAAAGTCCACGG + Intronic
1090559271 11:127913079-127913101 TGTCTAGTGCTGTAAGTACTTGG + Intergenic
1092949666 12:13489703-13489725 TGTCCACAGCCAAAAGTACATGG - Intergenic
1093379500 12:18475457-18475479 TGTCCAATTCTAAAATGACATGG + Intronic
1093592595 12:20921625-20921647 TCTGAAATGCTGCAAGTACATGG - Intergenic
1094097209 12:26720077-26720099 TGTATACAGCTGAAAGTACAGGG + Intronic
1094497928 12:31000661-31000683 TGTCTAACGGTGAAAGTTCAAGG + Intergenic
1095601049 12:44013561-44013583 TCCCCACTGCTGAAAGTACAGGG + Intronic
1095609054 12:44105863-44105885 TTTCCCCTGCTGAAAGTATAAGG + Intronic
1096625968 12:52896228-52896250 AGCCCAATGCTGAATGGACAGGG + Intergenic
1099781902 12:87205911-87205933 TGTCCAATGTTGAAGGTAGGAGG - Intergenic
1100022461 12:90086596-90086618 TCTGCTATGCTGAAAGTACTAGG + Intergenic
1102737133 12:115172279-115172301 TATCCAATTCTGAAGGTGCAGGG + Intergenic
1103008096 12:117437888-117437910 TGCCGGATGCTGAAATTACATGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1105317925 13:19285124-19285146 TATCCACTGCTCATAGTACAAGG - Intergenic
1105351913 13:19623574-19623596 TGTCCTATGATGACAGTGCAAGG - Intergenic
1105366962 13:19774110-19774132 TGCTCATTGCTGAAACTACAAGG + Intronic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1107344687 13:39446497-39446519 TGTCCCATGCTGAATGTCCTAGG - Intronic
1107369956 13:39734675-39734697 TGTCCAGTGCTCAAAGTAGAGGG + Intronic
1109112497 13:58339720-58339742 TGCTCAATGCTGAAAGTAAAGGG + Intergenic
1111487061 13:88917533-88917555 TTTACCATGCTGAAAATACAAGG - Intergenic
1111514844 13:89315911-89315933 TTTCAAATGCTTAAGGTACAGGG - Intergenic
1111666265 13:91272571-91272593 TGACCATGGCTGATAGTACAGGG + Intergenic
1114585899 14:23813396-23813418 TGCTCAATGATGTAAGTACAAGG - Intergenic
1114956720 14:27830028-27830050 AGTCCAATGCTGCAGGAACATGG - Intergenic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1117316632 14:54577230-54577252 CGTACAAACCTGAAAGTACAGGG - Intronic
1117499510 14:56338120-56338142 TGTCCAATGCAGATAGGGCAGGG - Intergenic
1121285711 14:92734231-92734253 TGGCCAACGCTGACAGTCCATGG - Intronic
1122246447 14:100406571-100406593 TGTCCAATGATCAGAGTCCAAGG + Intronic
1122383687 14:101329383-101329405 CCTCCAAAGCTGAAAGCACAAGG + Intergenic
1123501945 15:20894735-20894757 TTTTCAATGCTACAAGTACATGG + Intergenic
1123559198 15:21468434-21468456 TTTTCAATGCTACAAGTACATGG + Intergenic
1123595429 15:21905715-21905737 TTTTCAATGCTACAAGTACATGG + Intergenic
1127563163 15:60160760-60160782 TGTCCTGTGCAGAAAGTTCAAGG - Intergenic
1129260130 15:74361536-74361558 TGACCATGGCTGATAGTACAGGG - Intronic
1202967546 15_KI270727v1_random:195593-195615 TTTTCAATGCTACAAGTACATGG + Intergenic
1133876321 16:9738272-9738294 TGTACAATGCAGAAAATAAAAGG + Intergenic
1134334960 16:13290047-13290069 TGTTCAATGCTGAATCTCCAGGG - Intergenic
1135433284 16:22405666-22405688 TGTCCACTGATGAAAGTGCTGGG - Intronic
1148498474 17:48070429-48070451 TGTTCAAAGCTCAAAGTAAACGG + Exonic
1151222686 17:72624801-72624823 TGTCCAATGCTGGAAGAAGAGGG - Intergenic
1156584463 18:38416334-38416356 TGCCCAATGCTTACAGTAGAAGG + Intergenic
1161745241 19:6055199-6055221 CATCCAATGTTGTAAGTACATGG + Intronic
1165686656 19:37827626-37827648 TGAACATTGCTGAAAGGACAAGG + Intergenic
1166273534 19:41734310-41734332 TGTCAAATCCTGAGAGTAGAGGG - Intronic
1166278602 19:41774154-41774176 TGTCAAATCCTGAGAGTAGAGGG - Intergenic
1166398012 19:42456712-42456734 TGTCAAATCCTGAGAGTAGAGGG + Intergenic
1166413851 19:42577507-42577529 TGTCAAATCCTGAAAGTAGAGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166450730 19:42898410-42898432 TGTCAAATCCTGAAAGTAAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
926478893 2:13363351-13363373 TGTCCAATGCTGAATGTGCAGGG - Intergenic
927438838 2:23094805-23094827 TGAGGAATGCTCAAAGTACAAGG + Intergenic
932690236 2:73907007-73907029 TGTGCAATGCTCACAGTCCAGGG + Intronic
934480562 2:94637968-94637990 AGTCCAATGCTGCAGGAACATGG + Intergenic
937238385 2:120444213-120444235 TGCCCACTGGTGAAAGCACATGG + Intergenic
937850765 2:126633237-126633259 TGTCCAATCCTAAAAATAAATGG + Intergenic
939183595 2:138833047-138833069 TTTCCAAAGCTGATACTACAAGG - Intergenic
939472257 2:142637950-142637972 TGTCCATTTCTGAAAGTCCTAGG - Intergenic
940082847 2:149824054-149824076 TGACAAAAGCTGTAAGTACAAGG + Intergenic
941196959 2:162464576-162464598 TGTCAAATGCTGTAAGAATAAGG - Intronic
942301197 2:174564067-174564089 TGTCCAAAGCTGTAATTAGAGGG + Intronic
943096217 2:183432356-183432378 AGCCCAATGCTGAAAATACCTGG - Intergenic
943366311 2:186970557-186970579 TATCCAATTATGAAAATACAGGG + Intergenic
945364303 2:208931881-208931903 TGTTCAATTCTGATAGTAGATGG + Intergenic
946970615 2:225086856-225086878 TCTGCAAGTCTGAAAGTACATGG - Intergenic
948198921 2:236115491-236115513 TGGGCATTGCAGAAAGTACAGGG + Intronic
1171470689 20:25368760-25368782 TGACCATGGCTGATAGTACAGGG + Intronic
1175004710 20:55669953-55669975 TGTCACATGGTGAAAGCACAGGG - Intergenic
1177417640 21:20815200-20815222 TGTCCAATGCTATAATGACAGGG - Intergenic
949805299 3:7949071-7949093 TTTCCAATCCTGGAAGCACAAGG + Intergenic
950383638 3:12638693-12638715 TGTACACTGCTGAAAATAAAGGG + Intronic
950740948 3:15051580-15051602 TGTCCTATGAGGAAAGAACAAGG + Exonic
952093423 3:29919805-29919827 TGTACAATGCTGAAAGCAGCAGG - Intronic
955216816 3:56990922-56990944 TGTGCAAAGCTGAGTGTACACGG - Intronic
955685191 3:61542269-61542291 AGACCAATGCTGAAAGCACCCGG - Intergenic
957591817 3:82208828-82208850 TGGCAAAGGCTGGAAGTACATGG - Intergenic
960675896 3:120194479-120194501 TGGCCTATGCTGACAGTACCTGG - Intronic
960758612 3:121048284-121048306 TCTCCAAGGCTGAAAGAAAAGGG - Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
964193070 3:154028691-154028713 TGTTAAATTCTGAAAGTTCAGGG - Intergenic
965203300 3:165688835-165688857 AGTCAATTGCTGGAAGTACAGGG + Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
969522334 4:7685756-7685778 TCTCCAAGGGTGAAAGTGCAGGG + Intronic
971381135 4:26099005-26099027 TGTCCAAGGGTGTAAGTACCAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972894933 4:43608424-43608446 TGTCCAATGGTTAAAGCACATGG - Intergenic
975835568 4:78419346-78419368 TGTCCAGTTCTGCCAGTACATGG - Intronic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
977413171 4:96694196-96694218 TGTACAATGCTGATTTTACAGGG + Intergenic
978828803 4:113057517-113057539 TGGCTAAGGCTGAAAGCACAAGG - Intronic
979158003 4:117422402-117422424 TGTCCAAGCCTGATAGCACAGGG + Intergenic
982806686 4:159773803-159773825 TGTTCAATGCTGAAAGCAAATGG - Intergenic
983568442 4:169178939-169178961 TGCCAAATGCTGGAAGTCCAGGG + Intronic
984737712 4:183126219-183126241 TGTCCACTGCTGACAGAACTGGG + Intronic
986776381 5:11017777-11017799 TGTCCAGTCCAGAAAGTTCATGG + Intronic
987195788 5:15524840-15524862 TGTCCCATGCTGAAGGAACAAGG + Intronic
988606313 5:32681260-32681282 TGAACAAGGCTGTAAGTACATGG + Intergenic
989411152 5:41121472-41121494 CTGCCAATGCTGAAGGTACATGG - Intergenic
989564948 5:42892810-42892832 TGACCATGGCTGATAGTACAGGG + Intergenic
989980074 5:50633114-50633136 TGACCATGGCTGATAGTACAGGG - Intergenic
990578191 5:57143883-57143905 TGTTCAATGCTGAAACTGGAGGG + Intergenic
991638811 5:68733284-68733306 TGTCCTGTGCTGAGAGTACATGG + Intergenic
993037716 5:82775468-82775490 TTTCCAATTCTGACTGTACATGG + Intergenic
993169908 5:84405298-84405320 AGTACAATGCTGAAAGCAAAAGG + Intergenic
996384206 5:122893341-122893363 TGTAGAATTGTGAAAGTACAAGG - Intronic
996548051 5:124701520-124701542 TGTCCAATGATGAATTTAGAAGG - Intronic
996575597 5:124973813-124973835 TGAAGAATGCTGACAGTACAGGG + Intergenic
996952262 5:129141403-129141425 TCTCAAAGTCTGAAAGTACATGG - Intergenic
997671386 5:135677031-135677053 TGTCTAATGCTAATAGTAGAGGG + Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1000486937 5:161858346-161858368 TGTCCTATGCCCAAAGTGCAGGG - Intronic
1004779481 6:18892600-18892622 GTACCAATGCTGAAAGTCCAAGG + Intergenic
1008882094 6:56390884-56390906 TGTCCAATGCTAAAAGTAGGTGG - Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1012646793 6:101694358-101694380 TGTTCAATGCTGTAAGTTAAAGG + Intronic
1013742147 6:113299830-113299852 TGGCCTATGCTGAAAGTGAAAGG - Intergenic
1014299047 6:119657503-119657525 TGTGCAATACTGGATGTACAAGG - Intergenic
1016468162 6:144347327-144347349 TGTCCAATGTGGAGGGTACAGGG + Intronic
1016623441 6:146139389-146139411 TGTCCAATGCTGAAAGTACAGGG + Intronic
1019111708 6:169722899-169722921 CGTCAAATGCTGGAAGTGCAAGG + Intronic
1022658233 7:32341021-32341043 TGACCATTGCTGAACCTACATGG - Intergenic
1024723148 7:52161126-52161148 TTTCTAAAGCTGAAAGTATATGG - Intergenic
1025167675 7:56727097-56727119 AGCCCAATGCTGAAACTCCATGG - Intergenic
1026279774 7:68911920-68911942 TGTTCAATGCAAAAAGTAGAAGG - Intergenic
1027766992 7:82356507-82356529 TATCTAATTCTGAAAGTATAAGG - Intronic
1028381681 7:90207254-90207276 CATCAAATGCTGAAAGCACATGG + Intronic
1033081631 7:138304242-138304264 ACTCCAATGCTGGAGGTACAAGG - Intergenic
1034931837 7:155169153-155169175 TGTGCAGTGCAGAAAGGACAGGG - Intergenic
1036114535 8:5944566-5944588 TCTCCAAAGATGAAAGGACAAGG + Intergenic
1039682678 8:39759180-39759202 TGTCCAATACTGAAAGAAAATGG + Intronic
1040848259 8:51869471-51869493 TGACCAATGCTGAAATAGCATGG - Intronic
1042041665 8:64598275-64598297 TAATCAATGCTGAAAGAACAAGG + Intronic
1043367157 8:79546130-79546152 TGTCCAGTGCTGAAAGTAGCTGG - Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1043822878 8:84890197-84890219 TCCCCAATGCTGAAAGGAAAGGG + Intronic
1044506558 8:93026925-93026947 AGTCGATTGCTGAAAGTTCAGGG + Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1050037676 9:1454422-1454444 TGTTCAATGCTGAATGCCCAAGG - Intergenic
1051031488 9:12685382-12685404 TGTCCCATGCTGAAATTTTAGGG - Intergenic
1053677272 9:40445972-40445994 AGTCCAATGCTGCAGGAACATGG - Intergenic
1053868521 9:42466495-42466517 TGTACACAGCTGAAAGTGCACGG + Intergenic
1053927029 9:43072127-43072149 AGTCCAATGCTGCAGGAACATGG - Intergenic
1054286447 9:63178949-63178971 AGTCCAATGCTGCAGGAACATGG + Intergenic
1054290345 9:63281499-63281521 AGTCCAATGCTGCAGGAACATGG - Intergenic
1054388368 9:64586034-64586056 AGTCCAATGCTGCAGGAACATGG - Intergenic
1054507350 9:65930323-65930345 AGTCCAATGCTGCAGGAACATGG + Intergenic
1058445507 9:105051390-105051412 TGCAAAATGCTGTAAGTACACGG - Intergenic
1060376395 9:123118381-123118403 TGTCCAGTGCTGAAACTGCCTGG + Intronic
1185966525 X:4611795-4611817 TGTCTAATGCTGAAATTGCAAGG + Intergenic
1185973352 X:4690092-4690114 AGTCCAATGGTGAAGGGACAAGG - Intergenic
1187370617 X:18702633-18702655 CTTCCAATGCTGAAAATACAAGG - Intronic
1189579145 X:42387404-42387426 TGTCCAATGGGGAAGGTATATGG + Intergenic
1190844399 X:54178287-54178309 TGTACAATACTGCCAGTACAAGG - Intronic
1190856560 X:54300933-54300955 TGTCCAAAGCTGAAACTAAAGGG + Intronic
1195135002 X:101896888-101896910 TGTTAAATCCTGAAAATACAGGG - Intronic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1197758838 X:130014073-130014095 TGTCCCTGGCTGAAAGGACAGGG - Exonic
1198125114 X:133636276-133636298 TGTACATAGCTGAAAGGACAAGG + Intronic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic