ID: 1016629520

View in Genome Browser
Species Human (GRCh38)
Location 6:146212092-146212114
Sequence ATGTATTAACTGAGGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016629514_1016629520 27 Left 1016629514 6:146212042-146212064 CCACAGGTGAAATTTATTCTTCA 0: 1
1: 0
2: 6
3: 50
4: 330
Right 1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG 0: 1
1: 0
2: 2
3: 8
4: 191
1016629517_1016629520 -5 Left 1016629517 6:146212074-146212096 CCTCAACTCTACTTTAACATGTA 0: 1
1: 0
2: 2
3: 22
4: 254
Right 1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG 0: 1
1: 0
2: 2
3: 8
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016629520 Original CRISPR ATGTATTAACTGAGGGAATC AGG Intronic
901249360 1:7763084-7763106 ATTTATTAACTGTGTGAATTGGG + Intronic
901277999 1:8007979-8008001 ATGTCATCACTGGGGGAATCTGG + Intronic
902684299 1:18066013-18066035 ATGTATGACCTGAGGGATTCTGG - Intergenic
905179845 1:36158653-36158675 ATGATTTAACTCAAGGAATCTGG + Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
911948598 1:104142536-104142558 GTCTATTCACTGAGAGAATCTGG - Intergenic
912915316 1:113808972-113808994 ATGTAGCCACTGAGGGAAACTGG + Intronic
913031651 1:114911149-114911171 ATATATTAATTGATGAAATCAGG - Intronic
913584463 1:120260241-120260263 ATTTTTTAAGTGAGGGAACCAGG + Intergenic
913623719 1:120638118-120638140 ATTTTTTAAGTGAGGGAACCAGG - Intergenic
913667517 1:121062103-121062125 GTGTATTAACTGAGGAAACTGGG - Intergenic
914019208 1:143849246-143849268 ATGTATTAACTGAGGAAACTGGG - Intergenic
914566459 1:148872097-148872119 ATTTTTTAAGTGAGGGAACCAGG + Intronic
914606360 1:149258143-149258165 ATTTTTTAAGTGAGGGAACCAGG - Intergenic
914657759 1:149757453-149757475 GTGTATTAACTGAGGAAACTGGG - Intergenic
915166464 1:153950710-153950732 ATCTATTAAGTGAAGGAATTGGG + Intronic
915546781 1:156603723-156603745 ATTTATTGAATGAGTGAATCAGG - Intergenic
916309638 1:163382252-163382274 ATTTATTAAGTGAGTGAATAGGG - Intergenic
916479958 1:165206099-165206121 ATTTTATAAATGAGGGAATCAGG - Intronic
916817647 1:168369187-168369209 CTGTATTATCTGAGGGGATCTGG + Intergenic
917006567 1:170421999-170422021 ATTTATTCACTGAAGAAATCTGG - Intergenic
918295350 1:183151165-183151187 ATGAAAACACTGAGGGAATCTGG - Intergenic
918341729 1:183573350-183573372 ATCTATTCACTGAGGGAGGCAGG - Intronic
921841980 1:219838432-219838454 ATGTATGAGCTGAGTGACTCTGG - Intronic
923106242 1:230856161-230856183 AAGGATTAAATGAGGTAATCTGG + Intronic
924464806 1:244290381-244290403 ATGGATTTACAGAGGGATTCTGG - Intergenic
924653597 1:245951937-245951959 ATATATTCACTAAAGGAATCAGG + Intronic
1063002879 10:1941127-1941149 ATCTCTTCACTGAGGCAATCGGG + Intergenic
1063079989 10:2758254-2758276 ATATATTAAATGAGGAAATTAGG - Intergenic
1065406040 10:25366317-25366339 ATGTATAAATTGATGTAATCTGG - Intronic
1067082365 10:43218901-43218923 TTGAATTGACTGAAGGAATCTGG + Intronic
1068812593 10:61273333-61273355 ATGTTTTAAATGAGGGAATGAGG + Intergenic
1069699539 10:70411999-70412021 ATTTAAAAAATGAGGGAATCTGG - Intronic
1070855553 10:79605767-79605789 ATGAAATAGCTGAGGGAAACGGG - Intergenic
1072240947 10:93495377-93495399 AAGGATTAAATGAGGAAATCCGG - Intergenic
1073419831 10:103415644-103415666 ATGTATTAGCTGTGTGACTCTGG - Intronic
1075491551 10:122875519-122875541 ATATAGAAACTGAGGTAATCAGG + Intronic
1077868312 11:6240868-6240890 TTCTTTCAACTGAGGGAATCAGG + Intronic
1078893991 11:15581890-15581912 ATTTTGTAACTGAGGGAACCGGG + Intergenic
1079029371 11:16974513-16974535 ATGTTATCACTGAGGGAAGCTGG - Intronic
1083628241 11:64082801-64082823 ATGTCTGAGCTGAGGGAAACAGG - Intronic
1086002389 11:81998720-81998742 ATGAAATAGCTGAGGGAAACAGG - Intergenic
1086487273 11:87320264-87320286 ATTTACTAACTGAGTGACTCTGG - Intronic
1089048689 11:115526892-115526914 ATATGTTAACTGAGGGAGGCTGG - Intergenic
1092783516 12:12008213-12008235 AGGAATTAACCCAGGGAATCTGG - Intergenic
1092829101 12:12426775-12426797 ATTTATTAGCTGTGTGAATCTGG - Intronic
1093230169 12:16534225-16534247 ATGTAGTAAATAAGGTAATCTGG + Intronic
1093754040 12:22832643-22832665 TTGAATAAAGTGAGGGAATCAGG + Intergenic
1094723051 12:33084938-33084960 AAGTATTAACTCAGCGAATGTGG + Intergenic
1095645198 12:44536220-44536242 AAGTATTTACTGAGTGAATAAGG - Intronic
1095781514 12:46065247-46065269 AGGTAAAAACTAAGGGAATCAGG + Intergenic
1097742533 12:63260898-63260920 ATGAATGAATGGAGGGAATCTGG + Intergenic
1098297773 12:69021627-69021649 CATTATTTACTGAGGGAATCAGG + Intergenic
1098566733 12:71945552-71945574 CTGTTTAAACTGAGGAAATCTGG + Intronic
1098831548 12:75370979-75371001 ATGCAATAGCTGAGGGAAGCTGG - Intronic
1099898314 12:88676869-88676891 GTGTATTAGCTGAGGGACCCAGG - Intergenic
1101223668 12:102666410-102666432 TTGTTTTAACTGTGGGAAGCAGG - Intergenic
1102628763 12:114258244-114258266 ATATATTAAATGAAAGAATCAGG - Intergenic
1103978695 12:124721614-124721636 ATGTATTAACTCATTTAATCTGG - Intergenic
1107046666 13:36000118-36000140 ATGGAAGAACTGAGGGAATAGGG - Intronic
1107499635 13:40960012-40960034 ATGTTAGAACTGAGGGAATATGG - Intronic
1108315503 13:49233147-49233169 ATGTAATAACTGAAGGAAATGGG + Intergenic
1109193184 13:59349771-59349793 ATGTAGTAAGTTAGGGAATTGGG - Intergenic
1109389419 13:61672989-61673011 ATTCACAAACTGAGGGAATCTGG + Intergenic
1109959891 13:69616242-69616264 AAGTAGTAGCTGAGGTAATCTGG + Intergenic
1110128445 13:71977689-71977711 ATGTCTTCACTGATGTAATCAGG - Intergenic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1112651481 13:101403474-101403496 ATGAGTTAAGTGAGGGAATTAGG - Intronic
1112920168 13:104602759-104602781 ATATATTAAGTGGGGCAATCAGG - Intergenic
1114946605 14:27689425-27689447 ATGTGTTAATTAAGGGAAACCGG + Intergenic
1115069305 14:29301893-29301915 ATGAATGATCTGAGGGAATTGGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1119142465 14:72279872-72279894 ATGTATTAATGCAGGGCATCAGG + Intronic
1120319684 14:82943602-82943624 ATACATTAACTCAGCGAATCTGG + Intergenic
1122429528 14:101631395-101631417 ATGTATTAAGTAAGTGAATAAGG - Intergenic
1130394749 15:83492397-83492419 ATGTATTTACTGAAGAAATGTGG - Intronic
1131054287 15:89366518-89366540 GTGTATTGACTGCTGGAATCTGG + Intergenic
1131679606 15:94707626-94707648 ATGTATAAACTGAGAGGTTCAGG - Intergenic
1131888471 15:96946459-96946481 ATGTATTCACTGTGTGAGTCCGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1134187222 16:12094062-12094084 ATGTATTAGCAGTGGGAACCTGG + Intronic
1135584522 16:23658524-23658546 CTGTATTATCCGAGGGGATCTGG + Exonic
1138539843 16:57681200-57681222 ATGTATCCACAGGGGGAATCTGG - Intronic
1138615808 16:58165300-58165322 ATCTATTAACTCAGGGTAACAGG + Intronic
1144287413 17:13790997-13791019 TGGTATGAACTGAGGGAGTCTGG + Intergenic
1154510752 18:15099074-15099096 AGGAAGTAACTGATGGAATCAGG + Intergenic
1156378829 18:36538962-36538984 ATATAATCACTGAGGGAAACTGG + Intronic
1158507378 18:58058587-58058609 AAGAATTAACTGAAGGAATTTGG + Intronic
1159471051 18:68856631-68856653 CTGTATTAGCTGAAGGACTCAGG + Intronic
1164966212 19:32487056-32487078 CTTTATTAGCTGAGGGATTCTGG + Intergenic
1166650046 19:44566348-44566370 ATGTATTCATTGGGGGAAACTGG + Intergenic
1167340021 19:48909912-48909934 AGGTCTTTACAGAGGGAATCAGG - Intronic
1167770522 19:51512517-51512539 CTCTATTTACTGAGGGAGTCTGG + Intergenic
926691786 2:15740596-15740618 ATGTAACCACTGAGGGAAACTGG - Intronic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
930250236 2:49026865-49026887 AGGTCCTAACTGAGGGAATGAGG - Intronic
932237673 2:70134103-70134125 ATGAAATGACTGAAGGAATCTGG + Intergenic
933264408 2:80166765-80166787 TTGTATTAACTCTGGGAAGCTGG + Intronic
933644798 2:84802000-84802022 AAGTAATCACTGAGGGAATTTGG + Intronic
935318341 2:101860071-101860093 ATATGTTAACTGAGGCACTCTGG - Intronic
936716991 2:115198487-115198509 ATGTCTGAACTGGAGGAATCTGG - Intronic
937418007 2:121732525-121732547 ATGGCTTAACAGTGGGAATCAGG + Intronic
937566776 2:123302076-123302098 CTGTATTTATTGAGGTAATCAGG - Intergenic
937766683 2:125669415-125669437 TTGTAATAACTGAGGGAATCAGG + Intergenic
938505972 2:131883533-131883555 AGGAAGTAACTGATGGAATCAGG + Intergenic
938654358 2:133415538-133415560 ATGTATTATCTAAGGGAGTATGG - Intronic
938708716 2:133956763-133956785 GTGAATTGACTGAGGGAATGTGG - Intergenic
939049486 2:137290795-137290817 ATCCATTAACAGAGAGAATCAGG + Intronic
939620641 2:144414598-144414620 ATCTGTTAAATGAGGAAATCAGG - Intronic
939678322 2:145099459-145099481 ATGTACTAGCTGAGTGAACCAGG + Intergenic
940681227 2:156787549-156787571 ATGTATTAACTGAAGTAATCGGG + Intergenic
946375544 2:219306859-219306881 CAGTATTAAATGAGGAAATCAGG - Intronic
947932845 2:233977701-233977723 ATGTTTGAACTGAGTGAATAGGG + Intronic
1170883768 20:20320087-20320109 ATTTATTTGTTGAGGGAATCAGG - Intronic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1175370421 20:58484704-58484726 ATGTAATAACTCAGGGAGGCCGG + Intronic
1175568380 20:59999171-59999193 ATATGTTCACTGAGGGACTCAGG - Intronic
1177986268 21:27978847-27978869 AGGGAGTAACTGATGGAATCAGG - Intergenic
1178838180 21:36115832-36115854 ATGTATTAAGTGAGGAAAGGAGG - Intergenic
1179019126 21:37622289-37622311 ATGGAGTGACTGAGGGAATGAGG + Exonic
1179255273 21:39710539-39710561 AACTAGTAAATGAGGGAATCGGG + Intergenic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
955044334 3:55345693-55345715 ATGTAATCACTGGGGGAAACTGG + Intergenic
956760308 3:72437151-72437173 ATGTTTAAACTCAGGGAAACGGG - Intronic
959010669 3:101071866-101071888 TTGTATTGAGTGAGGGGATCAGG - Intergenic
960230839 3:115225439-115225461 ATGCATTACCTGAGTGATTCAGG + Intergenic
960264630 3:115606235-115606257 AGGAATTAAGTGAGGGATTCGGG + Intergenic
963063952 3:141247509-141247531 ATATAATAACTGATAGAATCAGG - Intronic
963179099 3:142335222-142335244 AACTATTAAATGAGAGAATCAGG + Intronic
963885431 3:150576692-150576714 ATGTATTTACTAAGAGAAGCTGG + Intronic
966336045 3:178869430-178869452 ATGTATTTGCTGAGAGAATGAGG - Intergenic
966920945 3:184610938-184610960 ATGTCTTAGCTGAGAGAAGCGGG - Intronic
974712508 4:65618173-65618195 ATGTGTTAACTGAGGTCATTGGG - Intronic
975038356 4:69712314-69712336 ATGAAGGAACTGATGGAATCAGG + Intergenic
975187059 4:71416010-71416032 ATTTATTAGCTGAGGGACGCTGG - Intronic
976219833 4:82747341-82747363 ATTTATTAACTGTGAGACTCAGG - Intronic
978869600 4:113559238-113559260 ATGTATTAACTATTGGAATTCGG + Intronic
979788620 4:124750009-124750031 ATGAGATAACGGAGGGAATCAGG + Intergenic
980162322 4:129180657-129180679 TGTTATTAACTGAGGGACTCTGG + Intergenic
980997670 4:139795976-139795998 ATGTAATAATTGAGGGCATTTGG + Intronic
981425072 4:144593835-144593857 AGCTAGTAACTGATGGAATCAGG + Intergenic
981428460 4:144632511-144632533 ATTTATTTACTGAAGAAATCAGG - Intergenic
982263196 4:153514061-153514083 ATGCAGTATCTGAGGGAAACTGG - Intronic
990007050 5:50955825-50955847 ATGTACTAACTCTGGGACTCTGG + Intergenic
990050001 5:51486033-51486055 ATGTTTTACCTGTGGTAATCAGG - Intergenic
990218330 5:53559523-53559545 ATGTAATCACTGGGGGAAACAGG + Intergenic
990245721 5:53861711-53861733 ATGTAGTAAGTGAAGGATTCAGG + Intergenic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
993640916 5:90404277-90404299 AGGTATGAACCAAGGGAATCTGG + Intronic
993906876 5:93633152-93633174 ATTTATTAACTGATTGGATCAGG - Intronic
994548027 5:101193354-101193376 ATTTATTAATTCAGGGAATGTGG + Intergenic
994774974 5:104029194-104029216 ATGAAGTAACTGAGGGAAATTGG + Intergenic
998268858 5:140688722-140688744 ATTTATTAACTGAGGAAATTGGG + Intronic
998714891 5:144871977-144871999 ATCTATTAACTGAAGCATTCCGG - Intergenic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1004771648 6:18789720-18789742 ATATATTAGATGATGGAATCAGG + Intergenic
1005219127 6:23566012-23566034 CTGTATTTACTGAGAGAATAGGG - Intergenic
1006947421 6:37794135-37794157 ATATGTTCACTAAGGGAATCTGG - Intergenic
1007303379 6:40885615-40885637 GTGTATTTACTGAGGAAGTCCGG - Intergenic
1007338328 6:41171447-41171469 ATGAGTTAACAGAGGGAATTTGG + Intergenic
1010641012 6:78327297-78327319 ATGTATTTAAGGAGGGAAACAGG - Intergenic
1011339301 6:86295203-86295225 ATGTAATCACTGAGGGAAACTGG - Intergenic
1011562334 6:88633217-88633239 ATGTATTCAGTGGGGGGATCTGG - Intronic
1012254709 6:97018028-97018050 TTGTATTAACTAAGGTAATGTGG - Intronic
1012522937 6:100142623-100142645 ATGTAATAAATGAGGAAATGAGG + Intergenic
1013449737 6:110268300-110268322 ATCTATTAAGTGGTGGAATCAGG + Intronic
1015053076 6:128865419-128865441 ATGTATCAATTGAGGGAAAAAGG - Intergenic
1015262675 6:131256383-131256405 ATGAATTAATAGATGGAATCAGG - Intronic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1018033379 6:159862057-159862079 ATGTATCCACTGGGGGAAACTGG - Intergenic
1021272342 7:18605591-18605613 ATATATTCACTGAGAGAAACTGG + Intronic
1024469421 7:49751924-49751946 AGGTAATAAATGATGGAATCGGG + Intergenic
1027598970 7:80214408-80214430 ATGGATTCACTTGGGGAATCTGG - Intronic
1030727530 7:112942921-112942943 ATGGATTCACTGAAGGAAGCAGG + Intergenic
1031058449 7:117020887-117020909 ATGTGTTAATTGATGGGATCAGG + Intronic
1033130454 7:138741264-138741286 AGGTAGCAGCTGAGGGAATCGGG + Intronic
1034669532 7:152847602-152847624 ATGAAGTAGCTGAAGGAATCTGG + Intronic
1035459984 7:159032569-159032591 ATGCGTTAATAGAGGGAATCAGG - Intronic
1038120564 8:24609633-24609655 ATGTCTTTACAGAGGCAATCAGG + Intergenic
1039269210 8:35862495-35862517 ATTTTTTAGCTGAGGGAATGGGG - Intergenic
1043389529 8:79779060-79779082 ATGTGTTTACTCATGGAATCTGG + Intergenic
1043632390 8:82352516-82352538 ATGTACTAACTGTGTGAATGTGG - Intergenic
1044779603 8:95730542-95730564 ATGAATTAACAGAGGGGAACAGG - Intergenic
1045420242 8:102007414-102007436 ATGTATCAACTGATGAAATTCGG - Intronic
1046093943 8:109536041-109536063 ATATATTAACAAAGGGAAACAGG - Intergenic
1047199469 8:122752713-122752735 ATGTAATCACTGGGGGAAACTGG + Intergenic
1047963132 8:130025357-130025379 ATGTAATAACATAGGGAGTCTGG - Intergenic
1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG + Intergenic
1050304008 9:4288076-4288098 ATGTAAGAACTGAGGTTATCTGG - Intronic
1055403664 9:75951084-75951106 TAGTATTAACTGATGGAAACAGG + Intronic
1189118827 X:38371628-38371650 CTGTATTAATTGAGTGAATTTGG - Intronic
1190844403 X:54178410-54178432 ATGTATAAAATGAAGGAAACAGG + Intronic
1191768716 X:64732315-64732337 ATGGATGAACTGACGGAAGCAGG - Intergenic
1191951544 X:66598766-66598788 ATGTATTAACTGAAGAAATACGG + Intronic
1191975670 X:66868616-66868638 ATATATTAACTGTGGGACTTTGG - Intergenic
1194173005 X:90612007-90612029 ATTTATTAAATGAGTGAATAAGG + Intergenic
1196566182 X:117207486-117207508 ATGTAACAGCTGAGGAAATCAGG - Intergenic
1198576243 X:138013126-138013148 ATGTAGTCATTGAGGGACTCAGG + Intergenic
1199688701 X:150289767-150289789 ATGTAACAACTGAGGAAAACTGG + Intergenic
1200519230 Y:4189730-4189752 ATTTATTAAATGAGTGAATAAGG + Intergenic
1200877090 Y:8168563-8168585 CTGTATGAACAAAGGGAATCAGG + Intergenic
1201051003 Y:9935390-9935412 ATGTTGTAAGTGTGGGAATCTGG + Intergenic