ID: 1016633019

View in Genome Browser
Species Human (GRCh38)
Location 6:146254026-146254048
Sequence GTGTGTATGTATAAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 655}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016633013_1016633019 16 Left 1016633013 6:146253987-146254009 CCCTACATCCCAGGATAGTTATG 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG 0: 1
1: 0
2: 6
3: 61
4: 655
1016633016_1016633019 8 Left 1016633016 6:146253995-146254017 CCCAGGATAGTTATGAGGTTTAA 0: 1
1: 0
2: 4
3: 56
4: 300
Right 1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG 0: 1
1: 0
2: 6
3: 61
4: 655
1016633014_1016633019 15 Left 1016633014 6:146253988-146254010 CCTACATCCCAGGATAGTTATGA 0: 1
1: 0
2: 3
3: 36
4: 329
Right 1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG 0: 1
1: 0
2: 6
3: 61
4: 655
1016633017_1016633019 7 Left 1016633017 6:146253996-146254018 CCAGGATAGTTATGAGGTTTAAA 0: 1
1: 0
2: 5
3: 29
4: 239
Right 1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG 0: 1
1: 0
2: 6
3: 61
4: 655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016633019 Original CRISPR GTGTGTATGTATAAGTTTGA GGG Intronic
900293261 1:1934206-1934228 GTGTGTATGTGTGAGTGTTAGGG + Intronic
900771237 1:4546336-4546358 GTGTGTATGTATGTGTTGGACGG + Intergenic
900994953 1:6116259-6116281 GTGTGTATATATATGTTTGTTGG + Intronic
902625781 1:17675485-17675507 GTGTGTGTGTATAGGTGTGTGGG + Intronic
903258624 1:22119220-22119242 GTGTGTGTGTTTCAGTTTCATGG + Exonic
904015751 1:27419177-27419199 GTGTATATGTATGTGTTTGGGGG - Intronic
904205143 1:28849475-28849497 GTGTATGTGTATCAGTGTGAGGG - Intronic
904721941 1:32516840-32516862 GTATGTATGTATTTATTTGACGG + Intronic
905127923 1:35728915-35728937 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905893173 1:41529585-41529607 GAGTGTATGTATGTGTATGAAGG - Intronic
905893208 1:41529779-41529801 ATGTGTATGTATGAGTGTGTGGG - Intronic
906457961 1:46013847-46013869 GTGTGTGTGTATATGTGTGTTGG + Intronic
906925354 1:50110035-50110057 GTGTGTATGTGTAAGGATGCTGG + Intronic
907177959 1:52543196-52543218 GTGTGTGTGTATAATCTTTAGGG - Intronic
907183215 1:52588863-52588885 GTATGTATGCAAAAGTTGGAGGG + Intergenic
907199551 1:52714705-52714727 GTGTGTGTGTGTATGTGTGAGGG - Intergenic
907279914 1:53340603-53340625 GTGTGTATGGATAGGTGTGGGGG - Intergenic
909240602 1:73207775-73207797 ATGTATGTGTATAATTTTGAGGG - Intergenic
909497414 1:76293854-76293876 GTGTGTGTGTATGTGTGTGAGGG + Intronic
909910481 1:81251607-81251629 GTGTGTATGTATGTGTGTGAGGG + Intergenic
910575777 1:88762033-88762055 GGGTGGATGGATTAGTTTGAGGG + Intronic
910640346 1:89454095-89454117 GTGTGTATGTGTGTGTTTTATGG + Intergenic
911164607 1:94713531-94713553 GTGTGTGTGTATATGTGTGCAGG - Intergenic
911875336 1:103155192-103155214 GTGTGTATATATATGTGTGTGGG + Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
911944107 1:104084186-104084208 GTGTGTATGTACACTTTTGTTGG - Intergenic
912423248 1:109562429-109562451 GTGTGTGTGTATAAAATTTAGGG + Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913320338 1:117583421-117583443 GTGTATATGTATATGTTTGTGGG + Intergenic
913349269 1:117840296-117840318 ATGTGTATGTGTAATTTTTAAGG + Intergenic
913426910 1:118742070-118742092 GTGTGTATGTATATGCATAACGG + Intergenic
914395658 1:147265178-147265200 TTGGGTAAGTATGAGTTTGAGGG + Intronic
914912353 1:151797836-151797858 GTGTGTATGCAGAAGTTTTGTGG - Intergenic
914972334 1:152319326-152319348 GTGTGTGTGTGTGTGTTTGAAGG + Intronic
915061945 1:153193425-153193447 GTGTGCATGCACATGTTTGAGGG - Intergenic
915470829 1:156124784-156124806 GTGAGTATGTGTATATTTGAGGG + Intronic
916636087 1:166670235-166670257 GTGTGTGTTTATATGTTTGGAGG + Intergenic
916897559 1:169181352-169181374 GTGTGTGTGTAGGAATTTGAGGG - Intronic
917606743 1:176638962-176638984 GTGTGTGTGTATGTGTTTGTAGG + Intronic
918537878 1:185594456-185594478 GTGTGTGTGTATGTGTTTTAAGG - Intergenic
918938381 1:190954919-190954941 TGGTGTATGTATTAGTTTGGAGG + Intergenic
919928415 1:202205563-202205585 GTGTGTATGTGTATGTTTGAAGG - Intronic
919928427 1:202205687-202205709 GGGTGTGTGTGTATGTTTGAAGG - Intronic
920711712 1:208301702-208301724 GTGTGTGTGTTTATGTGTGAAGG + Intergenic
921205246 1:212843090-212843112 GTGTGTGTGTGTATGTTTGACGG - Intronic
921516794 1:216102948-216102970 GTGTGTATGTTTCAGTTTGAAGG - Intronic
923783237 1:237043385-237043407 GTGTGTGTGTGTAAGTGTAAGGG + Intronic
924017803 1:239746635-239746657 GGATGTAGGTATAAGTTTGAAGG + Intronic
924068237 1:240248348-240248370 GTATGTATGTATATGTTTTATGG + Intronic
924201731 1:241667411-241667433 GTGTCTATGTTCATGTTTGATGG - Intronic
924607677 1:245549127-245549149 GTGTGTGTGTGTAAGTGTGTAGG + Intronic
924705604 1:246499391-246499413 GTGTGTGTGTGTATATTTGATGG - Intronic
1063305418 10:4894702-4894724 GTGTGTGTGTCTATGTGTGATGG - Intergenic
1063331179 10:5161049-5161071 GTGTGTATATATATGTGTGTGGG + Intergenic
1063545351 10:6975929-6975951 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
1063826633 10:9905986-9906008 GTATGTATGTACATTTTTGAGGG - Intergenic
1064819649 10:19312446-19312468 GTGTATATGTATATGTATAATGG + Intronic
1065176705 10:23083135-23083157 GTGTGTGTGTGTAATTTTAATGG - Intergenic
1065288562 10:24208391-24208413 GTGTGTGTGTGTAAGTGTGTTGG + Intronic
1065571590 10:27075947-27075969 ATATGTTTGTATAATTTTGAGGG - Intronic
1066374240 10:34843223-34843245 GTGTGTGTGTATGTGTGTGATGG + Intergenic
1066471674 10:35703862-35703884 GTGTGTGTGTGCAAGTGTGATGG - Intergenic
1066494018 10:35923635-35923657 GTGTGTATGTATGCGTGTGTAGG + Intergenic
1066515557 10:36155914-36155936 GTTTCAATGTATAAGTTTGGTGG - Intergenic
1066625246 10:37399373-37399395 GTGTGTATGTATCTCTTTTATGG + Intergenic
1066750954 10:38656671-38656693 GTGTGTGTGTATATCTGTGAGGG + Intergenic
1066966092 10:42266442-42266464 GTGTGTGTGTATATCTGTGAGGG - Intergenic
1067851466 10:49757462-49757484 GTGGCTGTGTATAATTTTGATGG - Intronic
1068371824 10:56126899-56126921 GTTTCTTTGTATAAGTTTTATGG + Intergenic
1069083593 10:64114489-64114511 GTGTGTGTGTATAAGTAAGTGGG + Intergenic
1069128814 10:64672803-64672825 GTGTGTATGTGTGTGTTTGGGGG - Intergenic
1070123539 10:73601453-73601475 GTGTGTGAGTATCAGGTTGAAGG - Intronic
1070631406 10:78087568-78087590 GTGTGTGTGTGTAAGCTTGGTGG + Intergenic
1070663965 10:78330451-78330473 ATGTGTATGTTTAAGATTGAGGG - Intergenic
1071433827 10:85628046-85628068 GTGCATATGTGTAAGTGTGAGGG + Intronic
1071433843 10:85628303-85628325 GTGTACATGTGTAAGTGTGAGGG + Intronic
1072678158 10:97484473-97484495 GTGTATATGTATATATATGAAGG - Intronic
1073488404 10:103836535-103836557 GTGTCTGTATATGAGTTTGAAGG - Intronic
1073493554 10:103871611-103871633 TTGTGTATGTGTATGTTTGTAGG - Intergenic
1073660505 10:105470892-105470914 GTGTGTGTGTGTAAGATTCAGGG - Intergenic
1073771142 10:106737065-106737087 GTGTGTATGTGTAGGTGTCAGGG + Intronic
1073812498 10:107165311-107165333 GTGTGTGTGTGTTAGTTTGGGGG + Intergenic
1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG + Intergenic
1074309014 10:112305939-112305961 GTGTGTGTGTATATATATGAGGG + Intergenic
1074390250 10:113051181-113051203 GTGTGTATGCACATGTATGAAGG - Intronic
1074755943 10:116624287-116624309 GTGTGAATGTGTAAGTTTCTGGG - Intronic
1074756867 10:116630128-116630150 GTGTGTATGTATGTGTGAGAGGG - Intronic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1075483019 10:122798451-122798473 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1076806182 10:132860102-132860124 GTGTGTCGGTATAAATTTGTAGG - Intronic
1077258686 11:1603737-1603759 GTGTGTATGTGTGTGTATGAGGG - Intergenic
1077258688 11:1603769-1603791 GTATGTATGTATGTGTATGAGGG - Intergenic
1077994872 11:7444573-7444595 CTGTGAATATATAATTTTGAAGG + Intronic
1078069075 11:8096557-8096579 GAGTGTGTGCATAAGTTTGTGGG + Intronic
1078798617 11:14620084-14620106 ATGTGTATGTGTATGTTTAAAGG + Intronic
1078963726 11:16311937-16311959 GTGTTTATGTGTATATTTGATGG - Intronic
1079215432 11:18506148-18506170 GTGTGTGTGTATAATTTGAAAGG + Intronic
1079286007 11:19133370-19133392 GTGTGTATATATATGTGTGTGGG - Intronic
1079348989 11:19676962-19676984 GTGTGCATGTGTGAGTTTGTGGG + Intronic
1080953110 11:37059487-37059509 GTGTGTATGTATATGTTACCAGG - Intergenic
1080981617 11:37414126-37414148 GTGTGTGTGTGTAAGTATGTTGG + Intergenic
1081022500 11:37964744-37964766 GTGAGTCTATATAAGTCTGAGGG - Intergenic
1081107522 11:39088969-39088991 GTGTGTGTGTATAAGAAAGAGGG - Intergenic
1081338013 11:41891367-41891389 GTGTGTATGTGTATGTGGGATGG + Intergenic
1081408482 11:42726314-42726336 GTGTGTATGTGTATGTGTGCTGG - Intergenic
1082200060 11:49355926-49355948 GTATGTATGTGTATGTTTAAAGG + Intergenic
1082852576 11:57778504-57778526 GTGTGGATCTAAAAGTTTGAAGG - Intronic
1083072389 11:59998859-59998881 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1083830230 11:65226899-65226921 GTGTGTGTGTGTAAGTATGTGGG - Intergenic
1084129016 11:67119257-67119279 GTGTGTATGTGAGAGTCTGACGG + Intronic
1085016724 11:73178703-73178725 GCTTGTGTGTATAAGCTTGAGGG + Intergenic
1085147047 11:74210055-74210077 GTATGTATGTATAAATGAGATGG - Intronic
1085356182 11:75839475-75839497 GTGTGTGTGTGTATTTTTGATGG + Intronic
1085379773 11:76104677-76104699 GTGTGCATGTATATGTGTGGTGG - Intronic
1085548581 11:77345178-77345200 GTGTGTATTGAGAGGTTTGAGGG + Intronic
1086022619 11:82249995-82250017 GTGTGTATGTGTACATGTGAGGG + Intergenic
1086655611 11:89350282-89350304 GTATGTATGTATATGTTTAAAGG - Intronic
1086819185 11:91413789-91413811 ATGTGTTTGTATAGTTTTGAGGG - Intergenic
1087903801 11:103672294-103672316 GTGTGTATGCATGTGTTTTAAGG + Intergenic
1088440258 11:109862650-109862672 GTGTGTATGTATATTACTGAAGG + Intergenic
1089420000 11:118324725-118324747 GTGTGTGTGTATACATATGATGG + Intergenic
1089623761 11:119738225-119738247 GTGTGTCTGTGTGGGTTTGATGG + Intergenic
1089750048 11:120645143-120645165 GTGTGTATGTGTATGTATGGTGG + Intronic
1089825767 11:121275363-121275385 GTGTGTATATATATGATCGATGG - Intergenic
1090002550 11:122975144-122975166 GTGTGTGTGTGTAAATTAGATGG - Intergenic
1090537194 11:127656168-127656190 GTGTGTAGGTGGAAGTTTGTGGG + Intergenic
1090585557 11:128208166-128208188 GTGTGTATGTATGTGTGTGTTGG - Intergenic
1090743252 11:129685962-129685984 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1091150732 11:133326303-133326325 GTGGGTATGTATAAGTGTGTGGG + Intronic
1091150762 11:133326464-133326486 GTGTGTGTGTATGTGTATGAGGG + Intronic
1091150772 11:133326514-133326536 GTGGGTATGTGTAAGTGTGTGGG + Intronic
1091512441 12:1142525-1142547 ATGTGCATTTATAATTTTGATGG + Intronic
1091900355 12:4139688-4139710 GTGTGTGTGCATATGTGTGATGG - Intergenic
1092068218 12:5610803-5610825 GTGTGTATGGACAACTCTGATGG - Intronic
1092240232 12:6831593-6831615 GTGTGTATGCATGAGTTTGGGGG - Intronic
1092825357 12:12393943-12393965 GTGTGTATGTTTACTTTTTATGG + Intronic
1093108696 12:15122097-15122119 GTGTGTATGTATATTTTTTCAGG - Intronic
1094260471 12:28491971-28491993 GTGTGTGTGTGTCTGTTTGAAGG + Intronic
1094457756 12:30657486-30657508 ATTTGTATGGGTAAGTTTGAAGG - Intronic
1095268810 12:40192369-40192391 GTGTATGTGTATACATTTGAGGG - Intergenic
1096819846 12:54225442-54225464 CTGTGTGTATATAAGTTGGAAGG - Intergenic
1096997497 12:55847959-55847981 GTGTGTATGTCTGTGTTTGTGGG - Intergenic
1097906867 12:64929863-64929885 GTGTGTGTGTGTGTGTTTGATGG + Intergenic
1098314551 12:69179577-69179599 GTGTGTGTGTGTGTGTTTGAAGG - Intergenic
1098654469 12:73010519-73010541 ATGTATTTGTATAATTTTGAGGG + Intergenic
1099014469 12:77327561-77327583 GTGTGTATGTGTTTGTGTGAAGG + Intergenic
1099197656 12:79638070-79638092 GTGTGTATCTCTAATTTTTATGG + Intronic
1099598390 12:84699210-84699232 GTGTGTATGTGTGTGTGTGATGG + Intergenic
1099668024 12:85655726-85655748 GTGTGTGTGTGTATGTGTGATGG + Intergenic
1099702659 12:86107364-86107386 GTGTGTGTGTTTAATTTTTAAGG + Intronic
1100176730 12:92039054-92039076 GTGTATCTGTAGAAGTTGGAAGG - Intronic
1100532875 12:95476749-95476771 GTGAGTATTAATAAGATTGAGGG + Intronic
1100864538 12:98842895-98842917 CTATGTATGTATATTTTTGAGGG + Intronic
1100942697 12:99741200-99741222 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1101436772 12:104670853-104670875 GTGTATATGTATAGGTGTGGGGG - Intronic
1104242767 12:127006828-127006850 GTGTCTGTGTATATGTTTGTAGG - Intergenic
1104470295 12:129024789-129024811 GTGTGTAGGTGTAAGTGTGGAGG - Intergenic
1104470342 12:129025028-129025050 GTGTGTAGGTGTAAGTGTGGGGG - Intergenic
1104470392 12:129025290-129025312 GTGTGTAGGTGTAAGTGTGGGGG - Intergenic
1104470441 12:129025527-129025549 GTGTGTAGGTGTAAGTGTGGGGG - Intergenic
1104585271 12:130043673-130043695 GTATGTGTGTATATGTTTGCAGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105906456 13:24815465-24815487 GTGTGTGTGTATAATTTGGGGGG + Intronic
1106202935 13:27557865-27557887 TTGTGTTTGTCTAATTTTGAAGG - Intronic
1107022006 13:35761422-35761444 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107022067 13:35762264-35762286 GTGTGTATGTGTAGGTGTGTAGG - Intergenic
1107022096 13:35762633-35762655 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1107796260 13:44055187-44055209 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1108260292 13:48649036-48649058 GTGTGTATGTATGTGTATGTGGG + Intergenic
1109135710 13:58647805-58647827 ATGTGTTTGTTTATGTTTGAAGG - Intergenic
1109722978 13:66300009-66300031 TTGTGTGTGTATAAATTTAATGG + Intergenic
1110353054 13:74532869-74532891 GTGTGTATATATATATATGAAGG - Intergenic
1110700067 13:78536602-78536624 GTGTGTGTGTGTATGTTGGAGGG - Intergenic
1110910066 13:80948318-80948340 GTATATATGTATAAGTTTACTGG - Intergenic
1111039527 13:82727786-82727808 GTGTGTATGTATGTGTCTGTGGG + Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1111154020 13:84298337-84298359 GTGTGTGTATGTAAGTTTAAGGG + Intergenic
1111187147 13:84752903-84752925 ATGTGTATATATAAGTTTTGAGG - Intergenic
1111827455 13:93285654-93285676 GTGTGTGTGTATGTGTTTGGTGG + Intronic
1112182910 13:97102968-97102990 ATGTGTATGTATGTGTGTGATGG - Intergenic
1112717761 13:102206122-102206144 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1113306458 13:109084524-109084546 GTGTATATGTATTTGTTTAAGGG + Intronic
1113963971 13:114141669-114141691 GTTTGTATGTGTATGTGTGAGGG - Intergenic
1114928878 14:27442317-27442339 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1114961262 14:27892777-27892799 GTGTTTATGTATATGTGTGGTGG - Intergenic
1115341333 14:32295800-32295822 GTGTGTATATATATATATGAAGG - Intergenic
1115371589 14:32621467-32621489 ATGTGTTTGTATAATTTTAAGGG + Intronic
1115471301 14:33771311-33771333 GTGTGTATGTGTGGGTTTGAGGG - Intronic
1115533820 14:34353853-34353875 GTATGTATGTATAAGCTGGAAGG + Intronic
1116362000 14:44011756-44011778 GTGTGTGTGTAACAATTTGATGG - Intergenic
1116944693 14:50825673-50825695 GTGTGCATGTGTAGGATTGAGGG - Intronic
1116983667 14:51196755-51196777 GTGTGTGTGTCTATGTTGGAAGG - Intergenic
1117208733 14:53472852-53472874 CTCTGTCTGTATCAGTTTGAAGG + Intergenic
1118061492 14:62143095-62143117 ATGTGTATGTATTAATTAGATGG + Intergenic
1118177973 14:63461837-63461859 GTGTGTGTGTGTATGTGTGAGGG - Intronic
1118906404 14:70026929-70026951 ATGTGTGTGTATGAGTGTGATGG + Intronic
1119531062 14:75361739-75361761 GTTTGTACCTATAAGTATGAAGG - Intergenic
1119981106 14:79082258-79082280 GTGTGTATATAAAAGGTTTAGGG - Intronic
1120313514 14:82861777-82861799 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1120356867 14:83445303-83445325 GTGCATATGTATAAGATTGGAGG + Intergenic
1120583566 14:86284074-86284096 GTGTGTATGTGTGTGTGTGAAGG - Intergenic
1120862572 14:89268004-89268026 GTGTGTATGTATTATTATGAAGG - Intronic
1121233173 14:92373159-92373181 GTGTGTGTGTATAAATTAGCTGG - Intronic
1121656319 14:95598878-95598900 GTGTGTGTGTGTATGTTTGTGGG + Intergenic
1122140057 14:99657960-99657982 GTGTGTATGTATGTGTGTGAAGG - Intronic
1122513243 14:102286951-102286973 GTGTGTGTGTATAGTTTTTAAGG - Intronic
1123915096 15:25016492-25016514 GTATGAATGTATGAATTTGACGG + Intergenic
1123989043 15:25669702-25669724 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1125029602 15:35063083-35063105 GTGTGTGTGTATGTGTGTGACGG + Intergenic
1125968064 15:43890139-43890161 CTGTGTGTGTATGAGATTGATGG - Intronic
1126964267 15:54033511-54033533 GTGTGTATATAAAATTTTGCTGG - Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1129061110 15:72861091-72861113 GTGTGTATGGAGAAGTTATAAGG + Intergenic
1129226476 15:74173419-74173441 GTGTGTGTGTACAAGTTTGTGGG - Intergenic
1129670395 15:77604673-77604695 GTGTGTCTGTGTCTGTTTGAGGG + Intergenic
1129856010 15:78825785-78825807 GTGTGTGTGTGTGTGTTTGATGG - Intronic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1130459742 15:84152116-84152138 GTGTATATGTATATGTGTGCGGG - Intergenic
1130535497 15:84782567-84782589 CTGTGTGTGCATTAGTTTGATGG + Intronic
1130758330 15:86790337-86790359 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1131901923 15:97097244-97097266 GTGTGTATGTGTGTGTTTGGAGG + Intergenic
1131955837 15:97735227-97735249 GTGTATGTGTATATGTTTGAGGG + Intergenic
1134331661 16:13256914-13256936 GTGTGTATGTGTATGTTTCTGGG - Intergenic
1134491028 16:14695268-14695290 GTGTGTATGTTTGTGTGTGATGG - Intergenic
1134496409 16:14734386-14734408 GTGTGTATGTTTGTGTGTGATGG - Intronic
1134832200 16:17332555-17332577 GTGTGTGTGTATGTGTGTGATGG - Intronic
1135204476 16:20471378-20471400 ATGTCTATGTATAAGTAGGAAGG - Intronic
1135354708 16:21759591-21759613 GTCTGCATTTATAATTTTGATGG + Intronic
1135453196 16:22575730-22575752 GTCTGCATTTATAATTTTGATGG + Intergenic
1137577101 16:49607425-49607447 CTGTGTATGTTGATGTTTGATGG + Intronic
1138587068 16:57977581-57977603 GTGTGTATGTGTGTGTTGGAAGG + Intronic
1138757661 16:59508214-59508236 GTGTGTATCTATAATTATGATGG - Intergenic
1139310270 16:66022273-66022295 GTATGTATGTATAGGTATGTGGG - Intergenic
1140268891 16:73445306-73445328 GTGTGTGTGTATATGTATGGGGG + Intergenic
1140895247 16:79318944-79318966 GTGTGTGTGTGTGAGTTTCATGG - Intergenic
1141229800 16:82155499-82155521 GTGTGTATGTATGGGGTGGAGGG - Intronic
1143442344 17:6984949-6984971 GTGTGTGTGTATGATTTTGATGG - Intronic
1143482768 17:7237090-7237112 GTGTTTATGGATAAATTTTAGGG - Intronic
1144304661 17:13957220-13957242 GTGTCTGTGTATAGGTTGGAGGG - Intergenic
1146540689 17:33691266-33691288 ATGTGCACGTATAATTTTGATGG + Intronic
1146558065 17:33844096-33844118 GTGTATATGTATAACTTTATTGG + Intronic
1147405073 17:40205611-40205633 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1148261269 17:46185648-46185670 GTGTATATATATATGTTTAATGG - Intronic
1148388054 17:47250385-47250407 GTGTGTATGTGTGTGTATGACGG + Intergenic
1149058789 17:52396091-52396113 GTGTGTATGTGTGTGTTTGTGGG + Intergenic
1149137477 17:53386288-53386310 GTGTGTGTGTATATATATGATGG - Intergenic
1149289622 17:55204801-55204823 GTGTGTGTGTTTAATCTTGAAGG - Intergenic
1149592276 17:57839381-57839403 GTGTACACGTATAAGTCTGATGG + Exonic
1150469897 17:65428240-65428262 GTGTGTGTGTATATATATGATGG - Intergenic
1150780623 17:68118756-68118778 ATGTGTATGTATTGATTTGAAGG - Intergenic
1150960137 17:69903721-69903743 GATTGTATGTGTAAATTTGAGGG - Intergenic
1150996749 17:70327142-70327164 GTGTGTGTGTATGAGTTTCTGGG + Intergenic
1151339627 17:73462329-73462351 GTATGCATGTATATGTTTTATGG + Intronic
1151388712 17:73771263-73771285 GTGTGTGTGTATGTGTTTGTAGG + Intergenic
1151613994 17:75196173-75196195 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1151924207 17:77182054-77182076 CTGTGTATAAATGAGTTTGAGGG + Intronic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1153137591 18:1934333-1934355 GTGTGTCTGCAACAGTTTGAGGG - Intergenic
1153376631 18:4387920-4387942 GTGTGTGTGTGTATGTGTGATGG - Intronic
1153906368 18:9665269-9665291 GTGTGTATGTAAAATATAGAAGG + Intergenic
1154229240 18:12539560-12539582 GTGTGTATGTGTATGTTTAAGGG - Intronic
1154285086 18:13047350-13047372 GTGTGTGTGTGTATGTTTGAGGG - Intronic
1155124467 18:22858223-22858245 GTGTGTATGAATGACTTGGAAGG - Intronic
1155767933 18:29659150-29659172 GTGTGTATGTGTATGTATGGGGG + Intergenic
1155802927 18:30131717-30131739 GTGTGTGTGTATAAAATTGTGGG + Intergenic
1156518282 18:37699370-37699392 GTGTGTATGTGTATGTGTGGTGG + Intergenic
1156538122 18:37883398-37883420 TTGTTTATTTATAAGTTTCAGGG - Intergenic
1157133800 18:45034430-45034452 GTGTGCAGGTAGAGGTTTGAGGG + Intronic
1157785385 18:50477312-50477334 GTGTGTATTTAAAAGTTGGCTGG + Intergenic
1157882891 18:51338581-51338603 GTGTATATGAATAATTTTTATGG + Intergenic
1158262352 18:55622140-55622162 GTGTGTGTGTGTAATCTTGAAGG - Intronic
1158776880 18:60593514-60593536 GTTTGTCTGTATAAGTTTCTGGG + Intergenic
1158975265 18:62705221-62705243 GTGTGTATAAATAAGTTTCAGGG + Intergenic
1159341060 18:67134050-67134072 GCGTGTATGTATGTGTTTGGTGG + Intergenic
1159524082 18:69565991-69566013 GTTTGTAAGTAAAATTTTGATGG + Intronic
1159537580 18:69735079-69735101 ATGTGGATGTATATATTTGAAGG - Intronic
1159611834 18:70534180-70534202 GTGTGTATTTTTAAGTTCTAAGG + Intergenic
1159927436 18:74281763-74281785 GTGTGTATGTGTGTGTTTCAGGG + Intronic
1160233132 18:77063918-77063940 GTGTGTATGTGTGTATTTGATGG + Intronic
1163044799 19:14632851-14632873 GTGTGTATGGATATGTAGGAAGG + Intronic
1163970791 19:20792491-20792513 GTGTGTGTGTATATTTTTCAGGG + Exonic
1164525494 19:29010354-29010376 AGGTGTATGTGTAAGTTAGATGG - Intergenic
1165639470 19:37371869-37371891 GTGTGTATATATGAGATTGTGGG + Intronic
1167072633 19:47229803-47229825 GTGTGTATGTATGTGTGTGGTGG - Intronic
1168231419 19:55034706-55034728 GTGTGTGTGTGTAAGAATGAGGG - Intronic
925156920 2:1655982-1656004 GTGTGTATCTATATGTTTGATGG - Intronic
925376983 2:3393498-3393520 GTGTGTGTGTATATGTGTGAGGG - Intronic
925844007 2:8019562-8019584 GTGTGCATGTATGTGTGTGAGGG + Intergenic
926624092 2:15075748-15075770 GTGTGTGTGTATAAATTTTGGGG - Intergenic
927100454 2:19783883-19783905 GTGTGTGTGTGTGTGTTTGAAGG - Intergenic
928136555 2:28692307-28692329 GTGTGTGTGTCTAGGGTTGAGGG - Intergenic
928884204 2:36129817-36129839 ATGTATATGTATAAATGTGATGG + Intergenic
929450375 2:42032965-42032987 GTGTGTGTGTGTATGTGTGACGG - Intergenic
930143718 2:47979980-47980002 GTGTGTATATATATATATGAAGG + Intergenic
930794605 2:55375513-55375535 GTATGTATGTATAAATATGTTGG + Intronic
930880921 2:56269347-56269369 GTGTGTGTGTGTGTGTTTGAAGG + Intronic
931093378 2:58911878-58911900 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
931168382 2:59775987-59776009 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
931901546 2:66794717-66794739 GTGTGTGTGTATGTGCTTGAGGG + Intergenic
932163869 2:69488164-69488186 GTGTGTGTGTGTGTGTTTGAGGG + Intronic
932984685 2:76711008-76711030 GTATGTATGTATATGTATGCAGG - Intergenic
933118954 2:78511378-78511400 GTGTGTATGAAAAATTCTGAGGG - Intergenic
933429532 2:82157872-82157894 GTGTGTGTGTATGTGTCTGAAGG - Intergenic
933542072 2:83658780-83658802 GTGTGTATGTGTGTGTTTTAAGG + Intergenic
934033621 2:88069435-88069457 GTGTGTATGTGTATGTGTCAGGG + Intronic
934167176 2:89304852-89304874 GTGTGTATGTGTGTGTTTGTGGG - Intergenic
934200102 2:89877592-89877614 GTGTGTATGTGTGTGTTTGTGGG + Intergenic
934928532 2:98399975-98399997 GTGTGTATGTATATATATGTTGG + Intergenic
936465710 2:112747493-112747515 GTGTATATGTGTAAGTGTCAGGG + Intronic
936845277 2:116823450-116823472 GTGTGTGTGTGTAACTATGAAGG + Intergenic
936879183 2:117229412-117229434 ATGTATTTGTATAATTTTGAAGG + Intergenic
937076031 2:119107590-119107612 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
937381616 2:121382610-121382632 GTGTGTATATGTCAGTATGAGGG + Intronic
937757178 2:125554396-125554418 GTGTGTTTGTGTATGTTTAAGGG - Intergenic
937904138 2:127044046-127044068 GTGTGAATGTGTGAGTGTGAAGG - Intergenic
937904142 2:127044124-127044146 GTGTGAATGTGTGAGTGTGAAGG - Intergenic
938939422 2:136156212-136156234 GTGTGTGTGTGTATGTGTGAAGG + Intergenic
939415167 2:141886921-141886943 GTGTGTGTGTATGTGTGTGAGGG + Intronic
939449207 2:142350945-142350967 GTGTGTATGTAGAATCTTTAAGG - Intergenic
939842859 2:147209812-147209834 ATGTGTGTGTATATATTTGAAGG + Intergenic
940630547 2:156232558-156232580 ATGTGTCTGTATAGTTTTGAGGG - Intergenic
940638946 2:156328635-156328657 GTGTGTATGTGTTTGTTTGTGGG - Intronic
940885038 2:158982291-158982313 GTGTATATGTATATTTTTAATGG - Intronic
941605855 2:167595489-167595511 GTGTGTATGTATATGTTCGGGGG + Intergenic
941878886 2:170461818-170461840 GTGTGTATGTATATGTATGGAGG + Intronic
942670087 2:178365757-178365779 GTGTGAAAGTTTAAGTTTCATGG - Intronic
942937752 2:181578238-181578260 GTGTGTATATATATGTGTGTGGG + Intronic
943354180 2:186831341-186831363 ATGTGTATGTATACGTGTGTGGG + Intronic
944185260 2:196940889-196940911 GTGTGTGTGTGTGAGTTTGTTGG - Intergenic
944282944 2:197918968-197918990 GTGTGTATGTGTGTGTGTGAGGG - Intronic
945502754 2:210597819-210597841 GTGTGTGTGTATATATATGAAGG - Intronic
947017860 2:225641416-225641438 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
947146545 2:227071746-227071768 ATGTATTTGTATAATTTTGAGGG - Intronic
947511123 2:230755042-230755064 GTATGTATGTATATATATGATGG - Intronic
1170296832 20:14836115-14836137 GTGTGTGTTTATTAGTTTTATGG - Intronic
1172226498 20:33308519-33308541 GTGTGTATGTATGTGTATAAAGG - Intronic
1172226501 20:33308597-33308619 GTGTGTATGTATGTGTATAAAGG - Intronic
1172226504 20:33308675-33308697 GTGTGTATGTATGTGTATAAAGG - Intronic
1172496207 20:35386864-35386886 GTGTGTGTTTATAAGTGTGTAGG - Intronic
1174021284 20:47531925-47531947 GTGAGGATGTACACGTTTGAGGG - Intronic
1174061303 20:47834847-47834869 GTGTTTCTGTTCAAGTTTGAGGG - Intergenic
1174070224 20:47894476-47894498 GTGTTTCTGTTCAAGTTTGAGGG + Intergenic
1174146789 20:48457783-48457805 GTGTGTATGCATGAGTGTGTGGG + Intergenic
1174153534 20:48502445-48502467 GTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1174156170 20:48516750-48516772 GTGTTTCTGTTCAAGTTTGAGGG - Intergenic
1174654627 20:52160374-52160396 CTGTGTGTGTATGTGTTTGAAGG - Exonic
1174998562 20:55600357-55600379 GTGTGTGTGTTTCAGGTTGAGGG - Intergenic
1175518483 20:59584414-59584436 GTGTGTATGCATGTGTGTGAGGG + Intronic
1175932766 20:62500617-62500639 GTGTATATGTGTGAGTGTGAGGG + Intergenic
1177110860 21:17026713-17026735 GTATGGATGAATAATTTTGATGG + Intergenic
1177240488 21:18449852-18449874 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
1177502757 21:21979830-21979852 GTGTGTCTGTCTATGTGTGATGG - Intergenic
1178727120 21:35063452-35063474 GTGTGTGTGTCTGAGTTTGTGGG - Intronic
1179304067 21:40139070-40139092 GTGTGTATGCATGAGTATGTGGG + Intronic
1179399023 21:41067126-41067148 GTGTGTATGTATGTGTGTGTGGG - Intergenic
1179467290 21:41584779-41584801 GGGTGTATGTATATGTGTGTGGG - Intergenic
1179933525 21:44588783-44588805 GTGTGTATATATATATATGATGG + Intronic
1180040115 21:45272751-45272773 ATGTGTTTGTATAGTTTTGAGGG - Intronic
1180616290 22:17130327-17130349 GTGTGAATGGATAACTGTGAAGG - Intronic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181401474 22:22652532-22652554 GTGTGTATGTGTGAGTGTGTGGG + Intergenic
1181868183 22:25876036-25876058 GTGTGTGTGTATGTGTTTTAAGG + Intronic
1182279774 22:29211224-29211246 GTGTGTATGTGAATGTGTGAGGG + Intronic
1182542422 22:31051351-31051373 GTGTGTGTGTATATGTTTTAAGG - Intergenic
1182931814 22:34181572-34181594 GTGTGTGTGTATGCGTGTGATGG + Intergenic
1182993921 22:34795388-34795410 GTCTGTATGTGTAGGTTTGGGGG - Intergenic
1183366156 22:37408143-37408165 CTGTGTATGTATAAATGTGTGGG - Intronic
1183762608 22:39837209-39837231 GTGTGTATATACCAATTTGAAGG - Intronic
1184713740 22:46268446-46268468 GTGTGTGTGTTGAAGTTTGAAGG + Intronic
1184824769 22:46942136-46942158 GTGTGTATATATATGTATGCTGG - Intronic
949243046 3:1893800-1893822 GTGTGTATGTATGGGTTGGTGGG + Intergenic
949676834 3:6464352-6464374 GTGTGTATGTGTGTGTGTGATGG - Intergenic
949818915 3:8093894-8093916 GTGTGTTTGTTTAAGTGTGTGGG - Intergenic
950325635 3:12107021-12107043 GTGTGTGTGTGTGTGTTTGAGGG + Intronic
950894603 3:16437387-16437409 GTGTGCATTTTTAGGTTTGAAGG + Intronic
951397751 3:22190726-22190748 CTGTGTATGGATATGTTTCAAGG - Intronic
951595834 3:24317161-24317183 GTCTGTAAGTATGAGTTTGTGGG + Intronic
951598058 3:24339732-24339754 ATGGGTATGTTTAAGTTGGAAGG - Intronic
951903124 3:27677113-27677135 GTGTGTATGTGTTTGGTTGAGGG - Intergenic
952719156 3:36514318-36514340 GTGTGAATGTGTGTGTTTGATGG - Intronic
953255851 3:41289877-41289899 GTGTGTGTGTGTATGTGTGACGG + Intronic
953579721 3:44143022-44143044 ATGAATATTTATAAGTTTGACGG + Intergenic
954021902 3:47749658-47749680 GTGTGTGTGTTTAATTTAGAGGG - Intronic
954021904 3:47749700-47749722 GTGTGTGTGTTTAATTTAGAGGG - Intronic
954587664 3:51750560-51750582 GTGTGTGTATATATATTTGAAGG - Intergenic
954968459 3:54631197-54631219 GTGTGTGTGTGTGTGTTTGATGG - Intronic
955410060 3:58649487-58649509 GTGTGTATGTATGTGTGTGAAGG - Intronic
955545904 3:60029919-60029941 GTGTGTGTGTACAAATGTGATGG + Intronic
956454859 3:69410396-69410418 GTGTGTGAGTATGAGTATGAGGG + Intronic
956571479 3:70701369-70701391 GTGTGTATGTATGTGTATGGGGG + Intergenic
956757206 3:72400631-72400653 GTGTGTATGCATGTGTTTGAAGG - Intronic
956801331 3:72762072-72762094 GTATGTATGTACATGTTTGTGGG - Intronic
956861811 3:73331634-73331656 GTGTGTGTGTATATATATGATGG - Intergenic
957281694 3:78158309-78158331 ATGTATTTGTATAATTTTGAGGG - Intergenic
957377156 3:79372596-79372618 GTGTGTATGTATTTTTCTGAGGG - Intronic
957669214 3:83279569-83279591 GTCTGTGTGTATATGTTTAAAGG + Intergenic
957921509 3:86754577-86754599 ATGTATTTGTATAATTTTGAGGG + Intergenic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
958650924 3:96935670-96935692 GTGTGTATATATAATGTTTAAGG - Intronic
958846082 3:99266420-99266442 GTGTGTGTGTATGACTTTAATGG + Intergenic
959970621 3:112405518-112405540 GTGTGTTTGTATATATTTGAAGG - Intergenic
960284478 3:115811576-115811598 GTGTGTGTGTAAAACTATGATGG + Intronic
960446335 3:117753462-117753484 GTGTGTACGTATATGTGTGTCGG + Intergenic
960929731 3:122834412-122834434 GTGTGTTTGTACAGTTTTGAGGG - Intronic
961848697 3:129793160-129793182 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
962092854 3:132263303-132263325 GTGTGTGTGTGTGAGTGTGAGGG - Intronic
962250878 3:133835391-133835413 GTGTGTTTGTGTAAGTGTGGGGG + Intronic
962298871 3:134219189-134219211 GGGTGAATATATATGTTTGAAGG - Intronic
962751777 3:138438974-138438996 GTGTTTATGTGTACTTTTGAAGG + Intronic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963335485 3:143970861-143970883 GTGTTTAGGGATAAGTTTCAGGG - Intergenic
964501553 3:157353636-157353658 GTATGTATGTACAAATTTGGAGG - Intronic
964738973 3:159945619-159945641 GTGTGTATGCATGAGTGGGAGGG - Intergenic
965088398 3:164130461-164130483 GTATGTACATATAAGTTTGGAGG + Intergenic
965154011 3:165022590-165022612 GTGTGTGTGTGTATGTGTGATGG - Intronic
965291835 3:166890698-166890720 GTGTGTATGTATACGTATATAGG - Intergenic
965462592 3:168986034-168986056 GTGTGTATGTTTGAGTGTGTAGG - Intergenic
965585591 3:170315055-170315077 GTGTGTGTGTATATATTTGCTGG + Intergenic
965867698 3:173225553-173225575 GTGTGTGTGTGTGAGTTTCAGGG + Intergenic
966302836 3:178497968-178497990 GTGTGCATGTATGTGTTGGAGGG - Intronic
967280019 3:187813233-187813255 GTTTGTATGGATGACTTTGAGGG - Intergenic
967374478 3:188785531-188785553 GTGTGTATATATATATATGATGG - Intronic
967465397 3:189799535-189799557 GTGTGTATGTGTTTGTTTTAAGG + Intronic
967735339 3:192945910-192945932 CTGTGTATATATAATTTTTATGG - Intergenic
968257613 3:197291290-197291312 GTGTGTGTGTGTAACTTTGTAGG - Intronic
969510720 4:7616276-7616298 GTGTGTATGTATATGTGAGTGGG - Intronic
970210522 4:13705258-13705280 GTGTGTATGTATATATGTAAGGG - Intergenic
970312299 4:14795512-14795534 ATGTGTATGCATAGTTTTGAAGG - Intergenic
970544415 4:17112588-17112610 GTGTGTATGTATCAGTATGGTGG + Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
971587055 4:28417208-28417230 GTGTGTATATATATATATGAAGG + Intergenic
971848762 4:31956151-31956173 GTGTGTGTGTATGTGTTTGTTGG - Intergenic
972830123 4:42805095-42805117 GTTTGTATGTATATTTATGATGG - Intergenic
973643463 4:52926365-52926387 GTGTGTATTTGTGTGTTTGAAGG - Intronic
974097450 4:57380049-57380071 GTGTGTATATATATATATGATGG + Intergenic
974242173 4:59263847-59263869 GTGTGTGTGTGTAAGTGTTAAGG - Intergenic
974304997 4:60124867-60124889 GTCTTTATTTAGAAGTTTGATGG - Intergenic
974692202 4:65310845-65310867 TTGTGTATGTATATTTTGGAAGG - Intergenic
974726121 4:65800704-65800726 GTGTGTCTGTATTATTTTTAGGG + Intergenic
974764527 4:66325444-66325466 GTGTGTGTGTGTATGTGTGAGGG - Intergenic
975009332 4:69329510-69329532 GTGTTTATATAAAAGCTTGAGGG + Intronic
976050223 4:81003206-81003228 GTGTGTATTTTTCAGTTTGTTGG + Intergenic
976499167 4:85767376-85767398 GTGTGTATATATGTGTATGATGG - Intronic
977042764 4:92035379-92035401 GTGTGTATATATATATTTAAAGG - Intergenic
977112815 4:92981159-92981181 GTATGTATGTATAATTTAGTAGG + Intronic
977481551 4:97584229-97584251 ATGTATTTGTATAATTTTGAGGG - Intronic
977540173 4:98308269-98308291 GTGTGTATATATATGTGTGTGGG - Intronic
978144168 4:105352516-105352538 GTGTGTGTATATGTGTTTGAAGG - Intergenic
978202883 4:106043753-106043775 GTGTGTATGTATATCTGTGTGGG + Exonic
978215470 4:106196155-106196177 GTGTGTATGTATATATTTCTAGG - Intronic
979159165 4:117436962-117436984 GTGTGTTTATATAAATTTAAAGG - Intergenic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979573789 4:122262229-122262251 GTGTCTAGGTATCAGTTTGCTGG + Intronic
980152770 4:129068533-129068555 GTCTATATGTATATGTTTGTTGG + Intronic
981923564 4:150114036-150114058 GTGTATTTGTATAGTTTTGAGGG + Intronic
981950583 4:150401843-150401865 GTGTGTATATATAATTATGTGGG + Intronic
982854834 4:160368192-160368214 GTGTGTATGTATATATTTGAAGG + Intergenic
982976791 4:162073254-162073276 GTGTGTATGTATATTTTTATGGG + Intronic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
984413991 4:179433729-179433751 GTGTGTGTGTGTATGTTGGAGGG + Intergenic
984611347 4:181843154-181843176 GAGTGTAAGGATGAGTTTGAAGG - Intergenic
985027051 4:185748403-185748425 GTGTGGAAGAATAAGATTGATGG - Intronic
985155179 4:186980099-186980121 GTGTGTGTATATAACTCTGATGG + Intergenic
985158066 4:187013989-187014011 GTGTGTGTGTGTATCTTTGAGGG + Intergenic
986901404 5:12438483-12438505 GTGTGTGTGTTTGAGATTGATGG + Intergenic
987542044 5:19268780-19268802 GTGTGTATGTATCTGTGTGTGGG - Intergenic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
988018041 5:25585366-25585388 ATGTATTTGTATAATTTTGAGGG + Intergenic
988089543 5:26518748-26518770 GTGTGTATATATAATTATAAAGG - Intergenic
988485383 5:31664413-31664435 GTGTCTGTGTATGAGTGTGATGG - Intronic
989041804 5:37237230-37237252 GTGTGTATATATATGTATCATGG + Intronic
989815878 5:45737126-45737148 GTGTGTGTGTATGTGTTTGTTGG + Intergenic
989815880 5:45737130-45737152 GTGTGTATGTGTTTGTTGGAGGG + Intergenic
990322297 5:54641791-54641813 GTGTGTATGTATGCGTGTGCGGG + Intergenic
990412414 5:55554174-55554196 GTCTTTATTTAGAAGTTTGAAGG + Intergenic
993206265 5:84883484-84883506 GTGTGTATGTATGTGTGTGTTGG + Intergenic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
993629097 5:90262324-90262346 GTGTGTATATATATATATGATGG - Intergenic
993818815 5:92588255-92588277 GTGTTTATGTATATGTGTGTGGG + Intergenic
993987970 5:94619342-94619364 GTGTGTATGTTTGTGTTTAAAGG - Intronic
994275890 5:97836872-97836894 GTGTTTATGTATTAGTTTCCTGG + Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
994902067 5:105786331-105786353 GTCTATATGTATAAAATTGATGG - Intergenic
994944785 5:106373056-106373078 GTGTTTAAGCATAAGTTTTATGG + Intergenic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995397229 5:111699814-111699836 GTGTATATGTGTATGTTTGTTGG + Intronic
995406584 5:111804496-111804518 GTGTGTATGTGTATGTATAAAGG + Intronic
995731454 5:115246970-115246992 GTGTTTATGTGTAAGTATGCAGG + Intronic
995740539 5:115351417-115351439 GTGTGTGTGTGTATGTTTGGTGG + Intergenic
996225528 5:120989506-120989528 GTGTGTGTGTATGAGTGTGTTGG - Intergenic
996593529 5:125175540-125175562 GTGTGTGTGTGTGAGTGTGACGG - Intergenic
996832747 5:127757837-127757859 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998237149 5:140407846-140407868 GTGTGTATGTGTGTGTGTGACGG + Intronic
998666906 5:144308067-144308089 CTGTGTACCTATTAGTTTGAAGG + Intronic
998728778 5:145049793-145049815 GTGTGTATATATATGTGTGTGGG + Intergenic
999041943 5:148423742-148423764 TTGAGTTTGTATGAGTTTGATGG + Intronic
999911394 5:156204461-156204483 GTGTGTGTGTATGAGTGTGTTGG - Intronic
999963703 5:156785057-156785079 GTGTGTCTGTATATGTGAGATGG - Intergenic
1000307427 5:160007861-160007883 GTGTGTGTGTATAAATTAGCTGG - Intergenic
1001609806 5:172991239-172991261 GTGTGTATATATAATTTTGCTGG + Intronic
1002951683 6:1819031-1819053 GTGTGTATGTGTGTGTGTGAAGG - Intronic
1003240555 6:4341682-4341704 GTGTGTGTGTATAATTTTTTTGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003718122 6:8669887-8669909 GTCTGTATGTATGTGTTTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004317935 6:14606992-14607014 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1004481148 6:16020401-16020423 GTGTGTGTGTCTAGGTGTGAAGG - Intergenic
1004481151 6:16020454-16020476 GTGTGTGTGTCTGTGTTTGAGGG - Intergenic
1004741767 6:18468648-18468670 GTGTGTATGTGTAGCTTTAAGGG + Exonic
1005335099 6:24788289-24788311 ATGTGTATGTATAACTTTTAAGG - Intergenic
1005636469 6:27757808-27757830 GTGTGTGTGTGTAATTTTCAGGG + Intergenic
1006672873 6:35740554-35740576 TTGTATATGTGTAAGTTAGAAGG + Intronic
1007526395 6:42498350-42498372 GTGTATTTGTATAGTTTTGAGGG + Intergenic
1008178422 6:48297272-48297294 GTGTGTATGTATATACTTGTTGG - Intergenic
1008274598 6:49528126-49528148 TTGTGTATGTATACCTTTCAAGG + Intergenic
1008697550 6:54058120-54058142 GTGTGTATGTGTATATTTTAGGG + Intronic
1008964334 6:57299092-57299114 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1009656712 6:66556224-66556246 ATGTATTTGTATAATTTTGATGG + Intergenic
1009774104 6:68182514-68182536 GTGTGTATGAATGTGTGTGAAGG - Intergenic
1009840443 6:69066153-69066175 ATGTGGATGTATATGTGTGAAGG - Intronic
1010161387 6:72860863-72860885 GTGTGTGTGTGTATGTTTTAGGG + Intronic
1010410985 6:75561313-75561335 TTGTGTATATATATGTTTAAAGG + Intergenic
1010923185 6:81710135-81710157 GTGTGTATATATATGTGTGTGGG + Intronic
1011241606 6:85277409-85277431 GTGTGTATGTATAGGGATGGAGG + Intergenic
1011350943 6:86423225-86423247 ATGTGTATGTATGGGGTTGAGGG + Intergenic
1011589182 6:88954738-88954760 GTGTATTTGTATAGCTTTGAGGG - Intronic
1012179307 6:96131437-96131459 GTGTGTATGTGTGTGTTTGGAGG - Intronic
1012272154 6:97226699-97226721 GTGTGTATATATATGTATGTAGG + Intronic
1013645051 6:112129192-112129214 GTGTGTGTGTGTATGTGTGATGG + Intronic
1013721163 6:113029889-113029911 GTGTGTATATATATATATGACGG - Intergenic
1013831859 6:114282081-114282103 ATGTGTATGTATGAGTTTATGGG + Intronic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1014031693 6:116712934-116712956 GTGTTTTTGTATAATTTTGAAGG - Intronic
1014047390 6:116906755-116906777 GTGTGTGTGTGTAATTTTTAGGG + Intronic
1014331865 6:120077852-120077874 GTGTGTCTGTGTGTGTTTGAGGG + Intergenic
1014350652 6:120340639-120340661 GTATATATGTATATATTTGAGGG - Intergenic
1015118315 6:129673944-129673966 GTGTGTATGTATTACTCTGTGGG - Intronic
1015378062 6:132533158-132533180 GTATGTATGTGTATGTTTAATGG + Intergenic
1015527255 6:134185580-134185602 GTGTGTGTGTATTAGTTTTCTGG + Intronic
1016132974 6:140500374-140500396 GTGTGTATGTCTAGGATGGAAGG + Intergenic
1016196984 6:141356070-141356092 GTGTGTATATATATATATGATGG - Intergenic
1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG + Intronic
1017293862 6:152772151-152772173 GTTTGCATGTAGAAGTTTTATGG + Intergenic
1017501318 6:155025815-155025837 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
1018151386 6:160943154-160943176 GTGTGTGTGTCTATGTTTGGAGG - Intergenic
1019217464 6:170453013-170453035 GTGTGTGTGTATGTGTGTGAGGG + Intergenic
1019265469 7:114802-114824 GTGTGTGTGTATACATTTTAGGG - Intergenic
1021299441 7:18954708-18954730 ATGTGTATGTATGTGTGTGAAGG - Intronic
1021338197 7:19430086-19430108 GTGTGTGTGTTTAAATTTAAGGG - Intergenic
1021434085 7:20594676-20594698 GTGTGTGTGTGTATGTTGGAGGG - Intergenic
1022517496 7:30985236-30985258 GTGTGTGTGTGTATGTGTGAGGG + Intronic
1022764133 7:33391433-33391455 GTGTGTATGTATGGGTATGCTGG - Intronic
1023715411 7:43038915-43038937 GCTTGTTTGGATAAGTTTGATGG - Intergenic
1023748449 7:43345787-43345809 GTGTGTGTGTATATATATGATGG - Intronic
1023921072 7:44630321-44630343 GTGGGTATGTGGAAGTCTGATGG + Intronic
1024050597 7:45620442-45620464 GTGTGTACTGATAAGTTTGATGG - Intronic
1024164596 7:46718153-46718175 TTGTGTTTGTATATTTTTGAGGG + Intronic
1024872855 7:53985721-53985743 GTGTGTATGTATAAGTGTGCGGG - Intergenic
1024893527 7:54229949-54229971 CTGTATATGTATAGTTTTGAGGG - Intergenic
1024900391 7:54312438-54312460 CTGTATATGTATAGTTTTGAGGG + Intergenic
1025233427 7:57218076-57218098 GTGTGTCAGTTGAAGTTTGATGG + Intergenic
1025233583 7:57218954-57218976 GTGTGTCAGTTGAAGTTTGAGGG + Intergenic
1025294432 7:57764246-57764268 GTGTGTATGTGTGTGTGTGAGGG + Intergenic
1026473873 7:70717493-70717515 GTGTGTATTTATATGTGTCAGGG + Intronic
1027675882 7:81157941-81157963 ATGTGTATGTGTATGTTGGAGGG + Intergenic
1027845464 7:83368153-83368175 TTGTGTATGTATGATTTTCAGGG - Intronic
1028272829 7:88814441-88814463 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1028347847 7:89805519-89805541 ATGTATATGTATAGTTTTGAGGG + Intergenic
1028645729 7:93094524-93094546 GTATGTATGTATAATTTTAGAGG + Intergenic
1029590733 7:101505294-101505316 GTGTGTATGCATGAGTGTGATGG + Intronic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1030054739 7:105574080-105574102 GTGTGTATATATATGGTTGCTGG - Intronic
1031247568 7:119336085-119336107 GTGTGTGTGTATATGTGTGCTGG - Intergenic
1031472894 7:122188984-122189006 GTGTGTGTGTGTAATCTTGAGGG - Intergenic
1031887321 7:127255142-127255164 GTGTGCATTGATAAATTTGAGGG + Intergenic
1032232506 7:130087713-130087735 GTGTGTATGTGTGTGTTTTAAGG - Intronic
1032244654 7:130199619-130199641 CTTTGTATTTATAAGTTAGAGGG - Intronic
1032601090 7:133296205-133296227 GTTTGTATGTGTATGTGTGAAGG + Intronic
1032826628 7:135576065-135576087 GTGTTTAGGGATAAGTTGGATGG + Intronic
1033400996 7:141025435-141025457 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
1033707706 7:143905040-143905062 TTGTGTGTGTATATGTTTTAGGG + Intergenic
1033807132 7:144967297-144967319 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1034858974 7:154580220-154580242 GTGTGTGTGTATAAGGGGGAGGG - Intronic
1035704271 8:1663134-1663156 GTGTGTATGTGTGAGTGTGGGGG + Intronic
1035877416 8:3206523-3206545 GTGTGTATGTATGTGTGTGTGGG + Intronic
1036012206 8:4738913-4738935 GTGTGTGTGTATGTGTTAGAAGG + Intronic
1036254085 8:7190371-7190393 GTGTGTATGTATAAGAGACAGGG + Intergenic
1036363406 8:8097116-8097138 GTGTGTATGTATAAGAGACAGGG - Intergenic
1036665851 8:10737636-10737658 CTGTGTAAATATAAGTTTTAAGG + Intronic
1037133407 8:15433559-15433581 ATGTGTGTGTATACGTGTGAAGG - Intronic
1038079048 8:24111520-24111542 GTGTGTGTGTTTAAATCTGATGG + Intergenic
1040442962 8:47464101-47464123 GTGTGTGTGTATAATCTTTAGGG - Intronic
1040974973 8:53180203-53180225 TTGTGTATTTATTACTTTGATGG + Intergenic
1041132905 8:54721939-54721961 ATGTTTATGTAAAAGTTTGTAGG + Intergenic
1041380486 8:57249478-57249500 GTGCGTAAGTATAAGATTGAGGG + Intergenic
1041381032 8:57254537-57254559 GGGTGTAGGTATGAGGTTGAGGG - Intergenic
1041970400 8:63734560-63734582 GTGGGTAGGTATATGTTTGGCGG + Intergenic
1042125305 8:65532291-65532313 GTGTGAATAAATAAGTTTGTGGG - Intergenic
1042201552 8:66283594-66283616 GTGTGTATATATATATATGATGG + Intergenic
1043026499 8:75076765-75076787 ATTTGTATGCATAAGTTTGGGGG - Intergenic
1043764103 8:84107153-84107175 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1043890679 8:85649612-85649634 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043893809 8:85720891-85720913 GTGTGTATGTATGTGTGTGAGGG - Intergenic
1043896489 8:85742340-85742362 GTGTGTATGTATGTGTGTGAGGG - Intergenic
1043898513 8:85757835-85757857 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043900125 8:85770029-85770051 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043902087 8:85785304-85785326 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043903696 8:85797497-85797519 GTGTGTATGTATGTGTGTCAGGG + Intergenic
1043905308 8:85809691-85809713 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043906918 8:85821878-85821900 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1044063795 8:87673263-87673285 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1044512848 8:93103384-93103406 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1044697939 8:94941938-94941960 GTGTATATGAATAAGTTTGTGGG - Intronic
1045095463 8:98792959-98792981 GTGTGTATGTATATATATGATGG + Intronic
1045684053 8:104692826-104692848 GTGTGTGTGTATATGTGTGGGGG - Intronic
1045878386 8:107009772-107009794 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1046167853 8:110462019-110462041 GTGTGTATGTATGTGTTTGGGGG + Intergenic
1046222143 8:111229956-111229978 GTGTATATATATATATTTGAAGG + Intergenic
1046248256 8:111594266-111594288 GTGTGTGTGTATGTGTATGATGG - Intergenic
1047171685 8:122499458-122499480 GTGTGTACGTATGTGTTTGGAGG - Intergenic
1047343942 8:124009398-124009420 GTGTTTTTGTTCAAGTTTGAGGG + Intronic
1047617801 8:126577437-126577459 GTGTGTGTGTATATGTGTGTTGG - Intergenic
1047835026 8:128680051-128680073 GTGTGTGTGTCTAAGATTCAAGG - Intergenic
1048657492 8:136557287-136557309 ATGTGGATGTATAAACTTGAGGG + Intergenic
1048852848 8:138661063-138661085 GTGTGTATGTATGTGTATGTGGG - Intronic
1048871852 8:138805509-138805531 GTGTGTGTGTATATGTGTGATGG + Intronic
1049251154 8:141589721-141589743 GTGTGTATGTATGTGTGTGCAGG + Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1049525486 8:143124117-143124139 GTGTGCATGTACATGTGTGAGGG - Intergenic
1049525577 8:143125050-143125072 GTGTGTGTGTACATGTTTGAGGG - Intergenic
1049525582 8:143125124-143125146 GGGTGTATGTACATGTGTGAGGG - Intergenic
1050225836 9:3454263-3454285 GTGTATATGTATGTGTTTGTGGG - Intronic
1051302277 9:15664555-15664577 GTGTGTGTGTATAAATTTAAGGG - Intronic
1051308604 9:15743978-15744000 GTGTTTATGTATAAGTCTACAGG + Intronic
1052045776 9:23792603-23792625 GTCTGTATGTATACAATTGATGG - Intronic
1052361492 9:27565467-27565489 ATGTATCTGTATAAGGTTGATGG - Intronic
1052631064 9:31039648-31039670 GTATGTATATATAATTTAGAAGG + Intergenic
1052638767 9:31136840-31136862 GTGTGCATGTATTTGTGTGAAGG + Intergenic
1053172967 9:35904205-35904227 GTGTGTATGTGTATGTGTGAGGG + Intergenic
1053512571 9:38701163-38701185 GTGTGTATGTGTACATTGGAAGG + Intergenic
1054813110 9:69450490-69450512 GTGTGTATGTGTATTTTTGGGGG + Intronic
1055185977 9:73454672-73454694 GTGTGTATGTGTATGTTTCAGGG + Intergenic
1055254167 9:74346264-74346286 GTGTGTATATATATATATGATGG - Intergenic
1055751268 9:79508012-79508034 GTGTGCATGTATGTGCTTGAAGG + Intergenic
1055917107 9:81415760-81415782 CTGTGTATGTGTATGTTTAATGG - Intergenic
1056039316 9:82645637-82645659 GTGTGTATGTGTAGGTGTAAAGG - Intergenic
1056279299 9:85024968-85024990 GTGTTTATGTATAAATTTATAGG + Exonic
1056289753 9:85131049-85131071 GTGTGTATATATATATATGATGG - Intergenic
1056316845 9:85398463-85398485 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
1056345577 9:85690986-85691008 GTGTTTATCTATAGGTCTGAAGG + Intronic
1056402753 9:86243946-86243968 GTGTGTATATATAAGGTGAATGG - Intronic
1056452664 9:86731535-86731557 GTGTGTATGTGTATGTTATAGGG - Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057340255 9:94194564-94194586 GTGTATTTGTATAGTTTTGAGGG + Intergenic
1057579126 9:96270235-96270257 GTGTGTGTGTATGTGTTTGGGGG - Intronic
1057586120 9:96330302-96330324 GTGTGTGTGTATATGTGTGGGGG - Intronic
1058306302 9:103445359-103445381 GTGTGTATTTGTATGTTTCAGGG - Intergenic
1059502656 9:114768222-114768244 GTGTGTATGTATGTGTGTGGGGG + Intergenic
1059694814 9:116721000-116721022 GTGTGTATGTATGTGCGTGAAGG - Intronic
1060488243 9:124063045-124063067 GAGAGTATGTATGAGTTTGGGGG - Intergenic
1061589041 9:131586519-131586541 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1061589057 9:131586789-131586811 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1062106820 9:134759721-134759743 GTGTGTGTGTATGAGTGTGGGGG - Intronic
1062106852 9:134759908-134759930 GTGTGCATGTATGAGTGTGGGGG - Intronic
1062106873 9:134760057-134760079 GTGTGCATGTATGAGTGTGGGGG - Intronic
1062106962 9:134760678-134760700 GTGTGCATGTATGAGTGTGGGGG - Intronic
1062205979 9:135337628-135337650 GTGTGTGTGCATATGTTTGAGGG + Intergenic
1185480183 X:440266-440288 GTGTGTCTGTATATGTCTGTGGG - Intergenic
1185824126 X:3233362-3233384 GTGTTTATGAAAAAGTTGGAAGG - Intergenic
1186076799 X:5888677-5888699 GTGTGTATATTTATGTTTAACGG + Intronic
1186082447 X:5947780-5947802 GGGTGTATGTGTATGTTTGTGGG + Intronic
1186568077 X:10685865-10685887 GTGTGTGTGTATGAGTATGTGGG - Intronic
1187719395 X:22135497-22135519 GTGTGTATGTATAGGTGTTGGGG + Intronic
1187812344 X:23193331-23193353 GTGTATGTGTATAAGTTTGCAGG - Intergenic
1188124334 X:26349792-26349814 GTGTGTATGTATACATCTGTTGG - Intergenic
1188184178 X:27092966-27092988 GAGTGTGTGTAGAAGTTTCAGGG - Intergenic
1188195968 X:27234188-27234210 GTGTGTAAGTAAAAATTTGGGGG - Intergenic
1188590444 X:31827766-31827788 ATGTGTTTGTATAGTTTTGAGGG - Intronic
1188630957 X:32359472-32359494 GAGTCTATGTCTAAGTTTCATGG - Intronic
1188697387 X:33212104-33212126 GTGTGTGTGTATAGGTCTCATGG + Intronic
1188815750 X:34711905-34711927 GTGTGTGTGTGTATGTTTAATGG + Intergenic
1188825146 X:34822673-34822695 ATGTATATGTATAGTTTTGAGGG + Intergenic
1189944797 X:46167177-46167199 GTATGTATGTATAACTTTGAAGG - Intergenic
1191625868 X:63270966-63270988 ATGTGTGTGTATATATTTGAAGG - Intergenic
1191995076 X:67085720-67085742 GTTTGTCTTTATAAGTTTGGTGG + Intergenic
1193052878 X:77119912-77119934 GTGTGTGTGTGTATGTTTTAGGG + Intergenic
1193264303 X:79450490-79450512 GTGTGTGTGTATAAAATTGATGG + Intergenic
1193965359 X:87978231-87978253 ATGTATTTGTATAATTTTGAGGG - Intergenic
1194652717 X:96534368-96534390 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1195933745 X:110105645-110105667 GTGTGTATGTATCAGACTGCAGG - Intronic
1196295198 X:113988893-113988915 GTGTGTGTGTATATATGTGAGGG + Intergenic
1196651369 X:118171676-118171698 GTGTGTATGTGTGTGTGTGATGG - Intergenic
1196678261 X:118443502-118443524 GTGTGTGTGTATATGTTTAAAGG - Intronic
1196784908 X:119413320-119413342 GTGTTTATGTATATATATGAAGG - Intronic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1196929478 X:120667003-120667025 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1197589356 X:128389687-128389709 GTGTGTATATATATATATGATGG + Intergenic
1197659542 X:129155362-129155384 ATGTGTATGTATACATTTGGGGG + Intergenic
1197930865 X:131695050-131695072 GTGTAAATGGAAAAGTTTGAAGG - Intergenic
1198159834 X:133996768-133996790 GTATGAATATACAAGTTTGATGG - Intergenic
1198232403 X:134704056-134704078 GGGTGTATGTAAAATTTTAAAGG + Intronic
1198496117 X:137195282-137195304 GTGTGTGTGTATACGGATGAGGG + Intergenic
1198950343 X:142062984-142063006 ATGTATTTGTATAATTTTGAGGG + Intergenic
1199061206 X:143357154-143357176 GTGGGTATGTAGAAATTTGTGGG - Intergenic
1199065730 X:143415769-143415791 GTATATTTGTATAATTTTGAGGG + Intergenic
1199670975 X:150148030-150148052 GTGTGTGTGTATTAGTATGCTGG + Intergenic
1199782886 X:151079630-151079652 GTGTGTGTGTATGAGTGTGTTGG + Intergenic
1200367271 X:155680176-155680198 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1201437680 Y:13977097-13977119 GTGTGTATGTTTAACTTTATAGG - Intergenic
1201512762 Y:14783733-14783755 GTTTGTATGTGTATGTTTGTGGG - Intronic
1202194180 Y:22279230-22279252 GTGTGTATATATATATTTGTGGG + Intergenic