ID: 1016633023

View in Genome Browser
Species Human (GRCh38)
Location 6:146254073-146254095
Sequence CTTTGGCTAATTAGGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016633020_1016633023 0 Left 1016633020 6:146254050-146254072 CCTTTGATTCTGAGTATAAACAA 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1016633023 6:146254073-146254095 CTTTGGCTAATTAGGAAAATAGG 0: 1
1: 0
2: 3
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016633023 Original CRISPR CTTTGGCTAATTAGGAAAAT AGG Intronic
906414109 1:45606148-45606170 TTTTGGCTATTTAGAGAAATCGG + Intronic
907736284 1:57115795-57115817 CTTTGGGTAATAAGGAAATGGGG + Intronic
908340952 1:63178553-63178575 ATGTGGCTAATTGGGAAATTGGG + Intergenic
908556604 1:65262805-65262827 CTTTGCCTACTTTGGTAAATTGG + Intronic
912058258 1:105632177-105632199 TTTTGGCTAAGTTGGAAAAGGGG + Intergenic
912760690 1:112364489-112364511 CTTTAGCTCATTTGAAAAATCGG - Intergenic
913027509 1:114859694-114859716 TTTTTGCTAATAAGCAAAATGGG + Intronic
915845467 1:159259479-159259501 TTGTGGCAAATGAGGAAAATAGG - Intergenic
916371650 1:164102908-164102930 TTTTGGCTAATTAGGAGTGTGGG + Intergenic
918451969 1:184667706-184667728 CATTGGTTAAATAGGAAAACAGG + Intergenic
918711842 1:187740922-187740944 CTTTGGCTATTTGGGAATTTTGG - Intergenic
919515131 1:198513042-198513064 ATTTGGAAAATTAGGAAGATGGG - Intergenic
919675331 1:200376653-200376675 CTTTGGCTTTTGAGTAAAATGGG - Intergenic
920980743 1:210832391-210832413 CTCTGGAGAATTGGGAAAATAGG - Intronic
921686256 1:218092437-218092459 GTTTGGTCAATGAGGAAAATTGG - Intergenic
1063445471 10:6111792-6111814 CCTGTGCTATTTAGGAAAATGGG + Intronic
1065148929 10:22801827-22801849 CTTTAACTAAATAGCAAAATAGG + Intergenic
1065947144 10:30615361-30615383 CGGTGGCTGGTTAGGAAAATGGG + Intronic
1066611027 10:37248646-37248668 CTTTAGCTAGTGAGTAAAATTGG + Intronic
1070295405 10:75156866-75156888 TTTGGGACAATTAGGAAAATTGG + Intronic
1070996831 10:80791568-80791590 CTTTTGCTCATTTTGAAAATTGG + Intergenic
1074208736 10:111308397-111308419 CTTTTACTAATAAGGAAACTGGG - Intergenic
1077969686 11:7175826-7175848 CTTTGGCTAATTGAAAAAATTGG + Intergenic
1078383454 11:10865305-10865327 CTTTGGTTAGTGAGGAGAATGGG - Intergenic
1079917930 11:26394443-26394465 CTTTGGCCAAATAGCAAAACTGG + Intronic
1080995842 11:37600343-37600365 CTTTGGCTAATGTTGAATATTGG - Intergenic
1081542677 11:44047667-44047689 GTTTGGTTAAATAGGAAAAAAGG - Intergenic
1085152389 11:74262584-74262606 TTTTGGCAAAGGAGGAAAATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086080096 11:82895215-82895237 ATTTTGCTGATTATGAAAATAGG + Intronic
1088160081 11:106858503-106858525 CTATGGGGAATTAGGAAACTTGG + Intronic
1088387015 11:109270051-109270073 CTTTGGGGACTTGGGAAAATTGG - Intergenic
1091870233 12:3883808-3883830 TTTTTTCTAATAAGGAAAATTGG - Intergenic
1091958200 12:4666208-4666230 CCTTGGCTAATTTTTAAAATTGG + Intronic
1092631776 12:10387404-10387426 CTTTTGCAAATTAGGAAAACTGG - Intronic
1092919028 12:13214433-13214455 CTATTGCTAATGAGGGAAATAGG + Intronic
1096211275 12:49767836-49767858 GTTTTGCTAACTAGGAAAGTTGG + Intergenic
1096478823 12:51924583-51924605 CTTTGTCTAGATAGGGAAATTGG - Intergenic
1097582748 12:61479078-61479100 TTTAGACTAATTAGGAAAAAGGG - Intergenic
1099210556 12:79782767-79782789 TTTTGGTAAATTAGTAAAATTGG - Intronic
1100559575 12:95734671-95734693 TTTTGCCTTATTAGGAACATAGG - Intronic
1101980614 12:109403350-109403372 CTTCAGATAATTAGGAAACTAGG + Intronic
1102082425 12:110109278-110109300 CTTAGGCAAAAAAGGAAAATGGG + Intergenic
1102778603 12:115543212-115543234 CTTTAGGTAATTAGGCCAATTGG - Intergenic
1104807752 12:131600267-131600289 CTTCTGATAATTAGGAAAATGGG - Intergenic
1105043495 12:132981496-132981518 CTTTTGCTCATTTGCAAAATTGG + Intergenic
1107068883 13:36247953-36247975 CTGTGGCAAATTTTGAAAATAGG - Intronic
1109559386 13:64026734-64026756 TTAAGGTTAATTAGGAAAATCGG - Intergenic
1110846642 13:80197313-80197335 CTGTTACTAATAAGGAAAATAGG - Intergenic
1112833472 13:103482699-103482721 CTTGTGCTAATTAGGAATAGAGG + Intergenic
1112889236 13:104211027-104211049 CTATGGCTAATAAGGGAACTGGG + Intergenic
1114621808 14:24100653-24100675 GTTTGGCCCATTAGGAAAAGAGG + Intronic
1115607660 14:35020837-35020859 CTTTTTCAAATTAGGAAACTGGG + Intronic
1115789201 14:36859747-36859769 CTTTGGCTACTTAGTAATCTGGG - Intronic
1116001973 14:39253421-39253443 CTTTCCCTAATTTGAAAAATGGG - Exonic
1117746219 14:58872189-58872211 TATTGGCTAATTCGGAAACTTGG - Intergenic
1118889036 14:69891972-69891994 TTTTGGCTAATTTAAAAAATAGG + Intronic
1119058252 14:71446211-71446233 TTTTAGCTAATTCAGAAAATAGG + Intronic
1120461433 14:84802202-84802224 CCTTTGCTAAGTAGGAAAATAGG + Intergenic
1121916940 14:97844175-97844197 CTTTGGCTACTTTGGAAACTAGG - Intergenic
1126599724 15:50416856-50416878 CTTTGGCTAAAAAAAAAAATTGG + Intergenic
1126913778 15:53442850-53442872 CTTTGGCTAGTTGGGGAAAGAGG - Intergenic
1127722258 15:61714841-61714863 CTTTAGATAAATAGGAATATAGG + Intergenic
1128790613 15:70431003-70431025 CTTTAGGTAAATGGGAAAATGGG + Intergenic
1129085517 15:73085783-73085805 CTTTTGCCCATTAAGAAAATTGG + Intronic
1130007928 15:80119441-80119463 ATTTTGCCAATTAGGAAAAAAGG - Intronic
1130679446 15:85983677-85983699 TTTGGGCTAATCAGGAAAATGGG + Intergenic
1131546447 15:93319740-93319762 ATTTGGCATATTAGGAAATTTGG - Intergenic
1131888525 15:96947181-96947203 CTTTAAGTCATTAGGAAAATGGG - Intergenic
1133823155 16:9254659-9254681 CTTTGACTAATTAGAACACTTGG - Intergenic
1137065606 16:35839564-35839586 ATTTTACTAATCAGGAAAATGGG + Intergenic
1137917604 16:52450000-52450022 CTTTTGCAGATTAGAAAAATTGG + Intronic
1137939775 16:52672908-52672930 TTTTGGCAAAGTAGGAGAATAGG - Intergenic
1139141094 16:64263621-64263643 CTTTGGCTGTCTAGGAAAAAAGG - Intergenic
1139284101 16:65795564-65795586 CTTTGGCTAATGGGTAAAATAGG + Intergenic
1143556512 17:7664910-7664932 GTTTAACTTATTAGGAAAATTGG + Intronic
1144365813 17:14543187-14543209 CTTTGAGTAATTAAGACAATTGG + Intergenic
1147814813 17:43201496-43201518 CTGTGGCTAAAGAGGAAAATGGG + Intronic
1148721024 17:49753326-49753348 CTTTGCCTAATTAAGCAAAAGGG + Intronic
1148777431 17:50103562-50103584 AGTTTGCTCATTAGGAAAATGGG - Intronic
1150258251 17:63767077-63767099 ATTTCACTAATAAGGAAAATGGG + Intronic
1151078936 17:71305728-71305750 CTTTGGCAAATTGGGTTAATTGG - Intergenic
1153294128 18:3529474-3529496 TTTTAGCTAATTAGGAAGAAAGG + Intronic
1155620635 18:27774718-27774740 CTTTGTCCAATAAGGAAAAATGG + Intergenic
1156235656 18:35201628-35201650 CTTAGGCTAATTAGTAAAAGGGG + Intergenic
1157120393 18:44904809-44904831 AGTTGGCAAAATAGGAAAATGGG + Intronic
1159564146 18:70029140-70029162 CTTTGGCTAGGGAGGAAAAGAGG + Intronic
1160306130 18:77739009-77739031 CTATGGCTGATTTGGAAAAGTGG + Intergenic
1164494630 19:28748887-28748909 TTTAGGCAAATTTGGAAAATAGG - Intergenic
1165806957 19:38586263-38586285 CTTTGGCCAGTTAGGAAAGGGGG + Intronic
1166250454 19:41565783-41565805 CAGTGGCAAAATAGGAAAATGGG + Intronic
1166352350 19:42205702-42205724 CTTAGGATAATTAGGAATTTTGG - Intronic
1168181637 19:54665926-54665948 CATTGGGTAAGTAGGAAATTGGG + Exonic
925617871 2:5761165-5761187 CTTTGTTTAATTAGGGAAACAGG - Intergenic
926544262 2:14219626-14219648 CATTGGACAATTGGGAAAATAGG - Intergenic
928717742 2:34082409-34082431 CTATGGGAAATTAGAAAAATTGG - Intergenic
929626757 2:43416702-43416724 CTTTGGATAATTATGAAAAGAGG + Intronic
929706090 2:44213563-44213585 CTTTTGCAAATTTGGAGAATGGG + Intronic
930283772 2:49402772-49402794 CTTTGCCTAATTAAGAAAATAGG + Intergenic
931060149 2:58519219-58519241 ATTTTGTTAATTAGGAAAAAAGG - Intergenic
931670222 2:64640781-64640803 CTTTGGGTCTTTAGAAAAATTGG - Intronic
931796971 2:65720657-65720679 CTTTGGTTAATTTAAAAAATGGG + Intergenic
932013112 2:67998263-67998285 CTTTGTCAACTGAGGAAAATTGG - Intergenic
932885941 2:75549381-75549403 CTTTGTCTACTGAGGAAAAGTGG + Intronic
933696934 2:85226604-85226626 GTTTGGGTGATTAGGAGAATGGG - Intronic
935486129 2:103656537-103656559 CGATAGCTAATTAGGTAAATAGG - Intergenic
937653730 2:124350310-124350332 CTTAGTGTTATTAGGAAAATTGG + Intronic
937818703 2:126283501-126283523 CTTTAGCTGATTAGGGAAAAAGG + Intergenic
938554277 2:132409961-132409983 CTTTGGCCCATTTAGAAAATGGG + Intergenic
939077302 2:137619213-137619235 CTTTGGATAAATTGGAAAAAGGG + Intronic
940626618 2:156183382-156183404 ATTTGGAAAATTAGTAAAATAGG + Intergenic
941727830 2:168883569-168883591 CTTTTGCTCATTTGTAAAATGGG + Intronic
943259018 2:185633669-185633691 CTTTGTCTAATTAGAAATAATGG - Intergenic
944148847 2:196536125-196536147 CCTTGGCCATTTAGAAAAATTGG - Intronic
944719510 2:202408996-202409018 CTTTGGCTAATTATGGGACTAGG - Intronic
944783601 2:203045321-203045343 CTTTGCTTAATTTTGAAAATTGG + Intronic
945638165 2:212385972-212385994 TTTTGGCAAATATGGAAAATGGG - Intronic
948285630 2:236782578-236782600 TTTTGTCTATTTAGCAAAATAGG + Intergenic
1170368386 20:15621320-15621342 CTATGGCTAGTTAGGAACTTAGG - Intronic
1170435387 20:16322015-16322037 CTTTGTCTCATTATGAAATTTGG + Intronic
1172859988 20:38041746-38041768 CTTTAGCCAGTTAGGAAATTTGG - Intronic
1174683131 20:52427437-52427459 CTCTTGCAAATTAGAAAAATGGG - Intergenic
1177108951 21:16999923-16999945 CTTTGCCCATTTATGAAAATTGG - Intergenic
1178464671 21:32836191-32836213 CTTTGGCTCTGTAGGAAAGTTGG - Intergenic
1178879722 21:36439681-36439703 CTTGGGCTAAGAGGGAAAATGGG + Intergenic
949394447 3:3600094-3600116 CATGGGCTAATGAGTAAAATAGG - Intergenic
950844777 3:16004241-16004263 TTTTGGGTAATTAACAAAATGGG + Intergenic
954272422 3:49520217-49520239 CTTCTGCTAATGAGGAACATGGG - Intronic
955169946 3:56553492-56553514 CTTTGGCTCATTTTTAAAATTGG + Intergenic
955378020 3:58414235-58414257 CTTGGGCATATTAAGAAAATTGG + Intronic
956060181 3:65341082-65341104 TTTTGGCCAATCATGAAAATTGG + Intergenic
957548979 3:81679537-81679559 CTTGGGATAATTTGGAAAATAGG + Intronic
957648821 3:82971751-82971773 CATTTGCTAATGTGGAAAATAGG - Intergenic
957648837 3:82971877-82971899 CATTTGCTAATGTGGAAAATAGG + Intergenic
959233839 3:103692455-103692477 CTTTGTTTTCTTAGGAAAATTGG + Intergenic
959656957 3:108818325-108818347 GTTTGGCCAATGAGGAAAATGGG + Intergenic
960636216 3:119787347-119787369 CTTTTGCAAATGAGGAAACTGGG - Intronic
961474659 3:127139009-127139031 CCTGGGCTAATTAGGGAAAGAGG + Intergenic
962406492 3:135105021-135105043 ATTTTGCTAATGAGGAAACTGGG - Intronic
965828492 3:172754385-172754407 CTTTGGTTCATTAAAAAAATGGG + Intronic
967045079 3:185728877-185728899 CTTGGTATGATTAGGAAAATGGG - Intronic
967947433 3:194815070-194815092 CTTTGACTATTTATGAAATTGGG - Intergenic
970784266 4:19777035-19777057 GTTTTACTAATTAGGAAAAGTGG + Intergenic
972813269 4:42614061-42614083 CTATGGCTAAATATGAGAATAGG - Intronic
974070861 4:57122200-57122222 AATTGGCTTATTAGGACAATTGG - Intergenic
974989393 4:69066057-69066079 CTATGGCTAATAAGGAAATGAGG - Intronic
975711626 4:77166072-77166094 CTTAGGATAAATATGAAAATAGG - Exonic
975896250 4:79094743-79094765 CTTTTGCTCATTAAAAAAATTGG + Intergenic
978732650 4:112048210-112048232 CTCTGGCTAATAAGGTAAAGTGG + Intergenic
979027928 4:115600469-115600491 CTGTGGCTACTTAGGAAAAGTGG + Intergenic
979429620 4:120612879-120612901 ATTTGGTTGATTAGTAAAATCGG + Intergenic
979522903 4:121688849-121688871 CTGTGGCCAACTAGGAAAAGGGG + Intronic
979838976 4:125413549-125413571 CTTTGCCTAATTTGAAACATGGG - Intronic
980928789 4:139165146-139165168 TTTTGGTTACTTAGGAAAACTGG + Intronic
981977762 4:150751481-150751503 ATTTGCATATTTAGGAAAATAGG - Intronic
984113827 4:175653146-175653168 CTTTTGCAAAATAGTAAAATGGG + Intronic
984481871 4:180314594-180314616 TCCTGGCTAATTAGGAAATTAGG - Intergenic
985517181 5:353093-353115 CTCTGGCTTATTAGGAGAATTGG + Intronic
988728485 5:33946890-33946912 CTTTTTCTAATTAGAAAAATGGG + Intronic
989662895 5:43818475-43818497 CCTTGGCTAATTTGTGAAATTGG + Intergenic
989776760 5:45218361-45218383 CTTTGGCCAATTTTAAAAATTGG - Intergenic
990471338 5:56118702-56118724 CTTTTGCTAATTTTTAAAATTGG - Intronic
990843618 5:60111597-60111619 CTTATGCTAATTAGTTAAATGGG - Intronic
991440482 5:66642420-66642442 CTTCAGACAATTAGGAAAATTGG + Intronic
991934360 5:71787233-71787255 CTTTGACTAAAATGGAAAATGGG + Intergenic
992129365 5:73675791-73675813 CCTTGGCTAAAAAGGAACATAGG + Intronic
997827458 5:137119615-137119637 CTTTGCCTTGTTAGGAAAACTGG - Intronic
998212898 5:140214737-140214759 CTTTGGGTAGTAAGGGAAATTGG + Intronic
999353418 5:150900381-150900403 CTTTGGCTCATGAGGGAAGTAGG - Intronic
999531892 5:152472641-152472663 GTGTGGCTAATTAAGTAAATTGG - Intergenic
1000204294 5:159043184-159043206 TTATGGCTAGTTAGGAACATTGG + Intronic
1003008544 6:2404715-2404737 CTCTGGCTAATAAGGAAAACGGG - Intergenic
1003320108 6:5043804-5043826 CTTTGGGTGATTAGGGAAAGTGG - Intergenic
1003941196 6:11028842-11028864 CTTTGACAGATCAGGAAAATGGG + Intronic
1004670268 6:17789356-17789378 CTTTTGCTGAATAGGAAAATTGG - Intronic
1004728107 6:18330691-18330713 CTTTTGCTACTTAGAAAATTGGG + Intergenic
1005096598 6:22123378-22123400 TTTTTGCTAATGAGGAAACTAGG + Intergenic
1006372653 6:33654948-33654970 CTTTGGATAAGCAGAAAAATTGG + Intronic
1009834293 6:68978660-68978682 CTTTGTCTAAGTAGCAAAACTGG + Intronic
1013914187 6:115314448-115314470 CTTTGGCAAATTTGGAAAAGTGG + Intergenic
1016306399 6:142689033-142689055 CTTTGCCCAATTAAAAAAATTGG - Intergenic
1016633023 6:146254073-146254095 CTTTGGCTAATTAGGAAAATAGG + Intronic
1016878161 6:148884160-148884182 CTTTGGCTAAGGAGCAAACTGGG + Intronic
1016996814 6:149966665-149966687 CTTTAGGTCATTAGGAATATAGG - Intronic
1017001986 6:150003582-150003604 CTTTAGGTCATTAGGAAGATAGG + Intergenic
1017011700 6:150068005-150068027 CTTTAGGTCATTAGGAAGATAGG + Intronic
1018002560 6:159592483-159592505 CTTTGGCAAAAAAGGAAAAGTGG + Intergenic
1018493904 6:164327678-164327700 CTTTGACGAATAAGGAAATTTGG + Intergenic
1018663271 6:166108617-166108639 CTTTGGCCACTTAAAAAAATGGG + Intergenic
1020321482 7:6941680-6941702 CTTTGAATACTAAGGAAAATAGG + Intergenic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1027939936 7:84664898-84664920 CTTTTCCTACTTAGAAAAATAGG - Intergenic
1028745706 7:94323999-94324021 CTTTGGCAGATGAGGAAAATAGG + Intergenic
1028848488 7:95509989-95510011 ATTTGGCTAATTAAAAAATTAGG + Intronic
1029520302 7:101056807-101056829 CTTGGGCTAATTGGAAACATTGG - Intronic
1030567885 7:111183402-111183424 CTCTGACTAATTATGGAAATTGG + Intronic
1032104122 7:129010979-129011001 CTTAGGATAATTAAGAAGATGGG - Intronic
1033823180 7:145158481-145158503 ATTTGTCTAATTAGGAACAAAGG - Intergenic
1034383459 7:150719137-150719159 CTTAGGGTAATAAGGAGAATGGG + Intronic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1035325103 7:158060753-158060775 CTTTGCCTATTTATGAATATGGG + Intronic
1037121342 8:15290798-15290820 TTCTTGCTAATTAAGAAAATGGG - Intergenic
1038593890 8:28867640-28867662 ATTTGGCAAATTAGTAAATTTGG + Intronic
1039307662 8:36280213-36280235 CTTTGGCCCATTGGAAAAATTGG + Intergenic
1039849489 8:41350943-41350965 CTTTGATTACTTAAGAAAATTGG - Intergenic
1041394925 8:57380468-57380490 GATTGGCTAATTTGGAAAATAGG - Intergenic
1044485339 8:92746173-92746195 CTTTGGCTCTTTAAGAGAATAGG - Intergenic
1045618387 8:103944924-103944946 CTTTGGCTAATTAGGCTAATAGG + Intronic
1046650904 8:116835547-116835569 CTTTGGCTATTTAGGCTATTTGG + Intronic
1046850176 8:118963245-118963267 CATTTCCTAATTTGGAAAATGGG - Intergenic
1047057574 8:121183095-121183117 CTTTAGCTAATGAAGATAATAGG - Intergenic
1047678780 8:127232035-127232057 ATTTTACAAATTAGGAAAATGGG - Intergenic
1047890017 8:129297744-129297766 CCTTTGCTAATTAAAAAAATAGG + Intergenic
1048140537 8:131790058-131790080 CTGTGGCTGATTGGGGAAATGGG + Intergenic
1048358615 8:133675099-133675121 CTTTGTCTTATTAGGAATTTAGG + Intergenic
1048413712 8:134202992-134203014 CTTGGTCTAATAGGGAAAATAGG + Intergenic
1048808258 8:138261086-138261108 TTTTGGATAAGTAGAAAAATGGG - Intronic
1051155617 9:14141529-14141551 CTTTTACTATTTAGAAAAATCGG - Intronic
1052279031 9:26712063-26712085 CTTTGGCTCAATGGAAAAATAGG - Intergenic
1057461388 9:95265865-95265887 TTATGGCTAATGAGGAAATTGGG + Intronic
1186996390 X:15128094-15128116 CATTGACAAATTGGGAAAATGGG - Intergenic
1187717125 X:22113864-22113886 CTTTGTTTAATGGGGAAAATTGG + Intronic
1188539092 X:31229706-31229728 ATTTGGAAAATTAGTAAAATAGG - Intronic
1192346602 X:70314029-70314051 GTGTGGCTAATGAGGAATATAGG + Intronic
1194427799 X:93761750-93761772 CATTGGGGAATCAGGAAAATTGG + Intergenic
1195967856 X:110445306-110445328 CTTTAGCTGATTTAGAAAATGGG + Intronic
1199697160 X:150350949-150350971 CTTTGGCCAATGAGGAAAGGAGG - Intergenic
1201370290 Y:13255570-13255592 CTTTTTTTAATTAGGAAAACTGG - Intronic
1201968427 Y:19764501-19764523 GTTTTACTAATCAGGAAAATGGG + Intergenic