ID: 1016633624

View in Genome Browser
Species Human (GRCh38)
Location 6:146260948-146260970
Sequence AGATACTGCTTGGCAAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016633622_1016633624 -3 Left 1016633622 6:146260928-146260950 CCTCTATATTTTTAGCATCTAGA 0: 1
1: 0
2: 3
3: 28
4: 283
Right 1016633624 6:146260948-146260970 AGATACTGCTTGGCAAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016633624 Original CRISPR AGATACTGCTTGGCAAAAGC CGG Intronic
No off target data available for this crispr