ID: 1016642652

View in Genome Browser
Species Human (GRCh38)
Location 6:146367166-146367188
Sequence GACTCCAAGAAAATACACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1073
Summary {0: 1, 1: 0, 2: 22, 3: 141, 4: 909}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016642652_1016642655 -4 Left 1016642652 6:146367166-146367188 CCCCAGTGTATTTTCTTGGAGTC 0: 1
1: 0
2: 22
3: 141
4: 909
Right 1016642655 6:146367185-146367207 AGTCTTTGTAGAAAATAAGATGG No data
1016642652_1016642656 22 Left 1016642652 6:146367166-146367188 CCCCAGTGTATTTTCTTGGAGTC 0: 1
1: 0
2: 22
3: 141
4: 909
Right 1016642656 6:146367211-146367233 TAAATATGTGAACTCATTTCTGG 0: 1
1: 2
2: 57
3: 250
4: 1056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016642652 Original CRISPR GACTCCAAGAAAATACACTG GGG (reversed) Intronic
900192593 1:1357804-1357826 GCCTCCAAAAAAATTCCCTGAGG + Intronic
902155692 1:14484027-14484049 GATGCCAAGAAAGTACAATGAGG - Intergenic
902155953 1:14486432-14486454 GATTCCAGGAAAATAAATTGAGG + Intergenic
903195560 1:21684808-21684830 GGCACCAAGAACATACACTGGGG - Intronic
904281287 1:29420964-29420986 GGTGCCAAGAACATACACTGGGG - Intergenic
905465158 1:38147689-38147711 GACCCCAAGAAATTTTACTGAGG - Intergenic
906123309 1:43410131-43410153 GATGCCAAGAACATACATTGGGG + Intronic
906352310 1:45072687-45072709 GGTGCCAAGAACATACACTGGGG - Intronic
906864341 1:49400145-49400167 GTTGCCAAGAACATACACTGGGG - Intronic
906915994 1:50010694-50010716 GGTGCCAAGAACATACACTGGGG + Intronic
907583854 1:55597116-55597138 GTTGCCAAGAACATACACTGAGG - Intergenic
907754748 1:57300709-57300731 GGCCCGAAGAAAATCCACTGGGG + Intronic
907961503 1:59287429-59287451 GGCACCAAGAACATTCACTGGGG + Intergenic
908112861 1:60914489-60914511 GGTGCCAAGAACATACACTGGGG - Intronic
908362709 1:63384741-63384763 GGTGCCAAGAACATACACTGGGG - Intronic
908397149 1:63736049-63736071 GATTCCAAGAACATACACTGCGG - Intergenic
908695862 1:66841061-66841083 GACACCCAGAAACTTCACTGAGG + Intronic
908712646 1:67033948-67033970 GGTGCCAAGAACATACACTGGGG - Intronic
909043204 1:70678207-70678229 GACCCCAAGTAGATACACTGAGG + Intergenic
909182076 1:72437157-72437179 GGTGCCAAGAACATACACTGAGG - Intergenic
909203398 1:72723780-72723802 AGCGCCAAGAACATACACTGGGG - Intergenic
909362680 1:74782433-74782455 GACTCCCGGAAAATGTACTGGGG - Intergenic
909421175 1:75467558-75467580 GGTGCCAAGAACATACACTGAGG + Intronic
909782468 1:79563596-79563618 GTTCCCAAGAAAACACACTGGGG + Intergenic
910705071 1:90120554-90120576 GCTGCCAAGAAGATACACTGGGG - Intergenic
911001129 1:93167025-93167047 GGTGCCAAGAACATACACTGAGG - Intronic
911012287 1:93293487-93293509 GGTCCCAAGAACATACACTGGGG + Intergenic
911014387 1:93316654-93316676 GGCACCAAGAACATACAATGGGG + Intergenic
911239036 1:95445036-95445058 GGTGCCAAGAACATACACTGGGG - Intergenic
911267497 1:95760894-95760916 GGTGCCAAGAACATACACTGGGG + Intergenic
911343408 1:96667828-96667850 GGTTTCAAGAACATACACTGGGG - Intergenic
911453277 1:98093151-98093173 GAGAACAAAAAAATACACTGTGG - Intergenic
911852995 1:102841998-102842020 AAGTCCAAGAAAATACACTGGGG + Intergenic
911887450 1:103322018-103322040 GTTTTCAAGAACATACACTGGGG - Intergenic
912000185 1:104823072-104823094 GAGGCCAAGAATATACAATGGGG - Intergenic
912005754 1:104898493-104898515 GTCGCCAAGAACATCCACTGGGG - Intergenic
912031478 1:105250085-105250107 GTTTCCAAGAATATACACTGGGG - Intergenic
912219388 1:107655348-107655370 GGCGCCAAGAACATACAATGAGG + Intronic
912486579 1:110033932-110033954 GACTCCAACAAGATATAGTGGGG - Intronic
912601569 1:110939711-110939733 GGTGCCAAGAAAATATACTGGGG + Intergenic
912632827 1:111262024-111262046 GACACCAAGAACATACACTGGGG - Intergenic
912762037 1:112376884-112376906 GACACCAGGAACATACACTGGGG - Intergenic
912859916 1:113204759-113204781 GATGCCAAGAACATATACTGGGG - Intergenic
912960872 1:114194621-114194643 GGTACCAAGAATATACACTGTGG - Intergenic
913042966 1:115046629-115046651 GGCACCAAGAACTTACACTGGGG + Intergenic
915043446 1:152988896-152988918 GGCCCCAAGAACATAAACTGGGG + Intergenic
915056635 1:153138599-153138621 GATGCCAAGAATATACATTGGGG + Intergenic
915337610 1:155155469-155155491 GGTGCCAAGAACATACACTGGGG + Intergenic
915768407 1:158391409-158391431 GACTCCATGAAAACCAACTGGGG - Intergenic
915986072 1:160466156-160466178 GCCTCCAAGAATACTCACTGGGG - Intergenic
916285255 1:163099126-163099148 GACCCCAAGAAATTTTACTGAGG - Intergenic
916339022 1:163707731-163707753 GTCTCCAAGAACATACAGTGGGG - Intergenic
916360997 1:163968468-163968490 GAGGCCAAGAACATACACTGAGG + Intergenic
916369052 1:164068562-164068584 GATGCCAAGAACATACATTGGGG - Intergenic
916774361 1:167944985-167945007 GCCGACAAGAACATACACTGTGG - Intronic
917225998 1:172783137-172783159 TATGCCAAGAATATACACTGAGG - Intergenic
917254531 1:173100048-173100070 GACTCCAAGAAAATAAACACAGG - Intergenic
917991450 1:180383897-180383919 GATGCCAAGAATATACATTGAGG + Intronic
918185641 1:182124759-182124781 GCCTCCAAGAGAATACAGTGAGG + Intergenic
918412550 1:184274871-184274893 GGTGCCAAGAACATACACTGGGG + Intergenic
918644911 1:186892559-186892581 GGTGCCAAGAACATACACTGGGG - Intronic
918868274 1:189932763-189932785 GTCTCTAAGTAAATACAATGAGG + Intergenic
919172711 1:193975642-193975664 GACACCAAGAACAAACATTGTGG - Intergenic
919224235 1:194674028-194674050 GGCTCCAAGGGCATACACTGGGG - Intergenic
919287982 1:195589836-195589858 GTTTCCAAGAACATACACTGGGG + Intergenic
919288952 1:195603410-195603432 GTTTCCAAGAACATACATTGGGG - Intergenic
920426162 1:205877573-205877595 AGCTTCAAGAACATACACTGGGG - Intergenic
920543774 1:206798885-206798907 GAGTCCAAGAATGTGCACTGAGG + Exonic
920592833 1:207238459-207238481 GGTGCCAAGAACATACACTGAGG + Intergenic
921147555 1:212373232-212373254 GGCACCAAGAAAATACAATTGGG + Intronic
921241699 1:213190911-213190933 GGTGCCAAGAAAATACACTGGGG - Intronic
921461822 1:215436474-215436496 GACGTGAAGAAAATACATTGAGG - Intergenic
921471143 1:215551564-215551586 GGCACCAAGAATATACATTGGGG - Intergenic
921823594 1:219646009-219646031 GATGCCAAGAACATACATTGGGG + Intergenic
921928953 1:220737851-220737873 GGCACCAAGAATATACACTGGGG - Intergenic
921963485 1:221062310-221062332 GAACCCAAGAAACAACACTGTGG + Intergenic
922028302 1:221773996-221774018 GAGTCCCAGATAATTCACTGAGG + Intergenic
922771704 1:228188320-228188342 GGTGCCAAGAACATACACTGGGG - Intergenic
923258308 1:232241593-232241615 GGTGCCAAGAACATACACTGAGG + Intergenic
923347122 1:233065594-233065616 GGATCCAAGGAAAAACACTGTGG + Intronic
924477827 1:244396892-244396914 GACCCCTAGAAATTTCACTGAGG + Intergenic
924491781 1:244545186-244545208 GACTGCAAGAAATTTCACTGAGG - Intronic
924647276 1:245889965-245889987 GGTGCCAAGAACATACACTGGGG + Intronic
924667913 1:246092488-246092510 GGCACCAAGAACATACATTGGGG + Intronic
924822855 1:247511102-247511124 GACTCCCACACAATAAACTGGGG - Intronic
924912226 1:248526336-248526358 GGTGCCAAGAACATACACTGGGG + Intergenic
1063206466 10:3836277-3836299 GAATACAAGAAAAAAAACTGAGG - Intergenic
1063493154 10:6483576-6483598 GACTCCCAGGAAATGCCCTGAGG + Exonic
1063774391 10:9244597-9244619 CCCTCCAAGAAAAGAGACTGGGG - Intergenic
1064696378 10:17970052-17970074 GGTCCCAAGAACATACACTGGGG - Intronic
1065540026 10:26754646-26754668 TCCTCCAAGAAAATATATTGTGG - Intronic
1065810135 10:29434991-29435013 GGTGCCAAGAACATACACTGGGG - Intergenic
1066015449 10:31238098-31238120 GGTGCCAAGAATATACACTGGGG + Intergenic
1066490540 10:35889815-35889837 CATTCTAAGAAAATACTCTGGGG + Intergenic
1066749604 10:38639774-38639796 AACTCTTAGAAAATACACTCTGG - Intergenic
1066967041 10:42278005-42278027 AACTCTTAGAAAATACACTCTGG + Intergenic
1067190954 10:44067750-44067772 GGTGCCAGGAAAATACACTGGGG + Intergenic
1067366510 10:45635397-45635419 GATGCCAAGAACATACACTGGGG + Intronic
1067371383 10:45686523-45686545 GATCCCCAGATAATACACTGAGG - Intergenic
1067388401 10:45839626-45839648 GATCCCCAGATAATACACTGAGG + Intronic
1067417666 10:46117331-46117353 GATCCCCAGATAATACACTGAGG - Intergenic
1067445868 10:46344952-46344974 GATCCCCAGATAATACACTGAGG - Intergenic
1067503080 10:46824219-46824241 GATCCCCAGATAATACACTGAGG - Intergenic
1067512522 10:46907811-46907833 GACTCTATAAAAATAAACTGTGG - Intergenic
1067591512 10:47515789-47515811 GATCCCCAGATAATACACTGAGG + Intronic
1067638627 10:48023865-48023887 GATCCCCAGATAATACACTGAGG + Intergenic
1067649722 10:48144011-48144033 GACTCTATAAAAATAAACTGTGG + Intergenic
1067688575 10:48484145-48484167 GGTGCCAAGAACATACACTGGGG - Intronic
1067764848 10:49077035-49077057 GACTCTGCTAAAATACACTGTGG - Intronic
1067854023 10:49776137-49776159 GACGGCAAGAATAGACACTGGGG + Intergenic
1067874854 10:49996437-49996459 GATCCCCAGATAATACACTGAGG - Intronic
1068252842 10:54466440-54466462 GACACCAAGAACCTACACTAGGG - Intronic
1068261813 10:54593437-54593459 GGCACCAAGAATACACACTGGGG - Intronic
1068325811 10:55484761-55484783 GGCACCAAGAACACACACTGGGG + Intronic
1068356620 10:55918199-55918221 GACACCAAAAACATACATTGGGG - Intergenic
1068479102 10:57566326-57566348 GGCACCAAGAATATTCACTGGGG - Intergenic
1068592857 10:58867746-58867768 AACTCCACAAAAATACCCTGAGG - Intergenic
1068697843 10:59987502-59987524 GATTCCAAGAACATACATTGGGG - Intergenic
1068833855 10:61530246-61530268 GACGCCAAGAACATACAATAGGG + Intergenic
1068839551 10:61594824-61594846 GGCTCCAGGAAAAAACAATGAGG + Intergenic
1069134589 10:64748057-64748079 GGTGCCAAGAACATACACTGGGG - Intergenic
1069249420 10:66249027-66249049 GTTGCCAAGAATATACACTGGGG + Intronic
1070446331 10:76507759-76507781 GGCATCAAGAACATACACTGGGG - Intronic
1070906808 10:80080007-80080029 GACACCAACAAACAACACTGTGG - Intronic
1071221257 10:83467646-83467668 GGTGCCAAGAATATACACTGGGG + Intergenic
1071245547 10:83758435-83758457 GGCACCAAGAACATACATTGAGG + Intergenic
1071364529 10:84884936-84884958 GACTCCTAGAAATTTTACTGAGG + Intergenic
1071678293 10:87678171-87678193 GGCGCCAAGACTATACACTGGGG + Intronic
1072209326 10:93232088-93232110 GACCCCTAGAAATTTCACTGAGG + Intergenic
1072502108 10:96027863-96027885 GGCCCCAAGAACATACACTGGGG + Intronic
1072941000 10:99763767-99763789 GATTCCAAGACAATTCAGTGGGG + Intergenic
1073706767 10:105992149-105992171 GGTTCCCAGAACATACACTGGGG + Intergenic
1074018005 10:109554510-109554532 GATGCCAAGAATATTCACTGGGG - Intergenic
1074273133 10:111974750-111974772 GACTCCCAGAATATATAATGTGG - Intergenic
1074638592 10:115350539-115350561 GGTGCCAAGAACATACACTGGGG - Intronic
1074804531 10:117035211-117035233 GGTGCCAAGAACATACACTGGGG + Intronic
1075018458 10:118928728-118928750 GAATCCAAGAAACTACACGGTGG + Intergenic
1075179041 10:120193778-120193800 GATGCCAAGAACATACACTGAGG - Intergenic
1076018305 10:127046984-127047006 GCATCCAACAAAATTCACTGAGG - Intronic
1076123226 10:127952944-127952966 GACCCCTAGAAATTTCACTGAGG - Intronic
1077882022 11:6358417-6358439 GACTTTAAAAGAATACACTGAGG - Intergenic
1078124630 11:8548372-8548394 GCCTCCAGAAACATACACTGTGG - Intronic
1078194399 11:9123081-9123103 GGCACCAAGAACATACACTGGGG + Intronic
1078761522 11:14255626-14255648 GACTGCAAGAAAACATACAGAGG - Exonic
1079534120 11:21490676-21490698 GGCACCAAGAATATATACTGAGG + Intronic
1079722875 11:23841464-23841486 GATGCCAAAAACATACACTGGGG - Intergenic
1080601410 11:33823868-33823890 GGCCCCAAGAACATACACTGGGG - Intergenic
1080703173 11:34662907-34662929 AATTCCAAGAAGCTACACTGAGG - Intergenic
1080889100 11:36393441-36393463 GGTGCCAAGAACATACACTGAGG - Intronic
1081212230 11:40350356-40350378 GGCACCAAGAACATACACTAGGG - Intronic
1081246163 11:40769706-40769728 GATGTCAAGAACATACACTGGGG + Intronic
1082688972 11:56277035-56277057 GGTGCCAAGAAAATACATTGGGG - Intergenic
1082901840 11:58262980-58263002 GTTGCCAAGAACATACACTGGGG - Intergenic
1082903722 11:58284109-58284131 GGTGCCAAGAATATACACTGGGG + Intergenic
1082911486 11:58380638-58380660 GACACCAAGAACACTCACTGGGG + Intergenic
1083002310 11:59304337-59304359 GCCGCCAAGAACATACATTGGGG - Intergenic
1083111305 11:60410701-60410723 GACACCAAGAATATTCAATGGGG - Intronic
1083210322 11:61180466-61180488 GGCACCAAGAACATACAATGGGG - Intergenic
1083984486 11:66203730-66203752 GGTGCCAAGAACATACACTGGGG + Intronic
1084013895 11:66367638-66367660 GACCCCCAGAGAAGACACTGAGG - Intronic
1085538227 11:77240364-77240386 GATGCCAAGAACATACAATGAGG + Intronic
1086123219 11:83322455-83322477 GGCACCAAGAACATACATTGGGG - Intergenic
1086128487 11:83375415-83375437 GATTCCAAGAATATACATTGGGG - Intergenic
1086248941 11:84790850-84790872 GGTGCCAAGAACATACACTGGGG - Intronic
1086261046 11:84940991-84941013 GGCACCAAGAACATACATTGGGG - Intronic
1086834053 11:91599956-91599978 GACTCCTAGAAATTTTACTGAGG - Intergenic
1086921273 11:92590032-92590054 GACACCAAAAGAATACAGTGAGG - Intronic
1087154669 11:94889276-94889298 GATGCCAAGAACATACACTGGGG - Intergenic
1087178173 11:95114758-95114780 GGTGCCAAGAACATACACTGGGG - Intronic
1087253221 11:95926968-95926990 GACATCAAGAAAACACACTGGGG + Intergenic
1087392935 11:97561861-97561883 GATTCCAAGAACGTACATTGGGG + Intergenic
1087401970 11:97678831-97678853 GGTGCCAAGAAAAGACACTGGGG - Intergenic
1087491981 11:98839296-98839318 GTCTCCAAGAACATGTACTGGGG - Intergenic
1087650775 11:100864496-100864518 TAATCAAAGATAATACACTGTGG + Intronic
1087720405 11:101658520-101658542 TATGCCAAGAACATACACTGGGG - Intronic
1087776434 11:102260976-102260998 GTCTCCAAAAAAATAAAGTGGGG - Intergenic
1087823557 11:102738882-102738904 GGTGCCAAGAACATACACTGGGG - Intergenic
1088013607 11:105033645-105033667 TACTCAAAGAAAATACAAGGAGG + Intronic
1089578445 11:119463800-119463822 GGTGCCAAGAACATACACTGGGG - Intergenic
1090303156 11:125665040-125665062 GATGCCAAGAACCTACACTGGGG - Intronic
1090316450 11:125793599-125793621 GGTGCCAAGAACATACACTGGGG - Intergenic
1090911601 11:131124635-131124657 GGCACCAAGAACATACACCGGGG - Intergenic
1091190505 11:133691198-133691220 GATGCCAAGACAATTCACTGGGG + Intergenic
1092941683 12:13414843-13414865 GGCACCAAGAACATACACTGGGG + Intergenic
1092950118 12:13494699-13494721 GGTGCCAAGAACATACACTGGGG - Intergenic
1093060935 12:14602918-14602940 GACACCAAGAACACACACTGGGG - Intergenic
1093064013 12:14637664-14637686 GGCTCCAAGAACATACAATGGGG + Intronic
1093162236 12:15761661-15761683 GGTGCCAAGAACATACACTGGGG + Intronic
1093531539 12:20170635-20170657 GTTGCCAAGAACATACACTGGGG - Intergenic
1093579974 12:20775780-20775802 GGTGCCAAGAACATACACTGTGG + Intergenic
1093617582 12:21246344-21246366 GATGCCAAGAACATACACTGCGG + Intergenic
1093681181 12:22005486-22005508 GGCACCAAGAATATGCACTGTGG - Intergenic
1093991994 12:25600174-25600196 GGTGCCAAGAACATACACTGGGG + Intronic
1094228286 12:28072298-28072320 GTTGCCAAGAAAATACAATGGGG + Intergenic
1094440945 12:30476186-30476208 GGTGCCAAGAACATACACTGGGG + Intergenic
1094714927 12:33003706-33003728 GATGCCAAGAATATTCACTGGGG - Intergenic
1094763618 12:33564335-33564357 GATGCCAAGAACATACCCTGGGG + Intergenic
1094773679 12:33696347-33696369 GGTGCCAAGAACATACACTGGGG - Intergenic
1095175355 12:39085636-39085658 GGCACCAAGAACATACATTGAGG - Intergenic
1095213060 12:39516423-39516445 GTTGCCAAGAATATACACTGGGG + Intergenic
1095622256 12:44271478-44271500 GATGCCAAGAAAATACAATAGGG + Intronic
1095829133 12:46564636-46564658 GACAACAAGAACATTCACTGGGG - Intergenic
1095853610 12:46837010-46837032 GGCACCAAGAGCATACACTGGGG - Intergenic
1098060795 12:66560045-66560067 GGTGCCAAGAATATACACTGGGG + Intronic
1098142574 12:67465515-67465537 CATGCCAAGAACATACACTGGGG - Intergenic
1098983003 12:76979167-76979189 GGCTCCAAGAATAAACAATGGGG - Intergenic
1099020226 12:77394101-77394123 GAGTCAAAGAAAATATACTTTGG + Intergenic
1099044179 12:77695414-77695436 GGTGCCAAGAATATACACTGGGG - Intergenic
1099236602 12:80090240-80090262 GTCAACAAGAATATACACTGGGG + Intergenic
1099406303 12:82267517-82267539 GGCGCCAAGAACATACACTGGGG + Intronic
1099421297 12:82464376-82464398 GATGTCAAGAATATACACTGGGG - Intronic
1099587590 12:84540542-84540564 GGTTCCAAGAACATACATTGGGG - Intergenic
1099763755 12:86955450-86955472 GGTGCCAAGAACATACACTGGGG - Intergenic
1099814505 12:87627774-87627796 GTCACCAAGAACATACAATGGGG - Intergenic
1099911878 12:88844274-88844296 GGCACCAAGAACATACATTGGGG + Intergenic
1099945696 12:89241363-89241385 GATGCCAAGAACATACATTGGGG - Intergenic
1100128978 12:91466540-91466562 GATTCCAAGAATATGCAATGGGG + Intergenic
1100360385 12:93872670-93872692 GGTGCCAAGAATATACACTGGGG - Intronic
1100414812 12:94360981-94361003 AGCACCAAGAAAATACATTGGGG + Intronic
1100776647 12:97982301-97982323 GACACCAAGAACTTATACTGGGG + Intergenic
1100801061 12:98231130-98231152 AAACCCAAGAAAATAAACTGAGG + Intergenic
1101792896 12:107946109-107946131 GGCTCCAATAACATACAATGGGG + Intergenic
1101807504 12:108077213-108077235 TGCTCCCAGAAAATAGACTGTGG + Intergenic
1102267385 12:111498924-111498946 GAAGCCATGAACATACACTGGGG + Intronic
1102885095 12:116515944-116515966 AACTCCATGAAAATTCACTCTGG + Intergenic
1103169845 12:118807753-118807775 GGTGCCAAGAACATACACTGGGG - Intergenic
1105313361 13:19233880-19233902 GGCACCGAGAAGATACACTGGGG + Intergenic
1106896294 13:34306218-34306240 GATTCTAAGAACATACATTGGGG + Intergenic
1108307100 13:49148476-49148498 GGTGCCAAGAACATACACTGGGG - Intronic
1108833831 13:54515249-54515271 GATGCCAAGAACATACAATGGGG + Intergenic
1108932734 13:55848837-55848859 GAGTGCTAGAACATACACTGTGG + Intergenic
1108988622 13:56627376-56627398 GGCACCAAGAACATACATTGGGG + Intergenic
1109022440 13:57115375-57115397 GGTTTCAAGAATATACACTGGGG - Intergenic
1109112349 13:58337337-58337359 GGTGCCAAGAACATACACTGGGG - Intergenic
1109336227 13:60998294-60998316 GTTTCCAAGAACATGCACTGGGG - Intergenic
1109392264 13:61708517-61708539 GACTCCAGGAAATTTCACTGAGG - Intergenic
1109817521 13:67604877-67604899 GGTACCAAGAACATACACTGAGG - Intergenic
1109851132 13:68065550-68065572 GATTCCAAGACAATTCAATGGGG - Intergenic
1109864908 13:68250675-68250697 GAAACCCAGGAAATACACTGAGG - Intergenic
1109933351 13:69245610-69245632 GACCCCTAGAAATTTCACTGAGG + Intergenic
1109934067 13:69258296-69258318 GTTTCCAAGAACATACGCTGTGG + Intergenic
1110486976 13:76057580-76057602 GGTACCAAGAACATACACTGGGG + Intergenic
1110501783 13:76236929-76236951 GATGCCAAGAACATACACTGGGG + Intergenic
1110635274 13:77760454-77760476 GGTTCCAAGAAAATAAAATGAGG - Intronic
1110663691 13:78090272-78090294 GGTGCCAAGAACATACACTGGGG + Intergenic
1110976661 13:81844920-81844942 GCCTCCACGAAAATACACAATGG - Intergenic
1111030824 13:82595977-82595999 AGCACCAAGAAAATACACTGGGG + Intergenic
1111328906 13:86736652-86736674 GATGCCAAGAACATACGCTGGGG + Intergenic
1111506030 13:89189578-89189600 GACACCAAGAACATACATTGTGG + Intergenic
1112601714 13:100862158-100862180 GACACCAAGAGGATACAATGAGG - Intergenic
1112618416 13:101029246-101029268 GGTGCCAAGAACATACACTGGGG - Intergenic
1112639888 13:101261127-101261149 GGTGCCAAGAACATACACTGGGG - Intronic
1112821299 13:103339335-103339357 GATGCTAAGAACATACACTGGGG + Intergenic
1113441962 13:110336080-110336102 AACTCCAAGAAGATACATAGAGG - Intronic
1114347621 14:21813190-21813212 GGTGCCAAGAACATACACTGGGG + Intergenic
1115011392 14:28550678-28550700 GATTCTAAGAAATTACACTAGGG - Intergenic
1115278124 14:31631087-31631109 GTCTCCAGGACAATAAACTGGGG + Intronic
1115279258 14:31642447-31642469 GATCCCAAGAACATACACTGTGG - Intronic
1115678386 14:35707990-35708012 AATGCCAAGAACATACACTGGGG + Intronic
1116031041 14:39572051-39572073 GGCTCCCAGAACATACAGTGGGG - Intergenic
1116059308 14:39900573-39900595 GGTGCCAAGAACATACACTGGGG - Intergenic
1116231208 14:42219529-42219551 GAAACCAAGCAAATACAATGAGG + Intergenic
1116264920 14:42675579-42675601 GATGCCAAGAACATACACTGAGG + Intergenic
1116579354 14:46619227-46619249 GTCACCAAGAATATACAATGGGG - Intergenic
1116668476 14:47809895-47809917 GACACCAAGAACATATATTGGGG - Intergenic
1116803650 14:49469331-49469353 GGTTCCAAGAACATACATTGGGG + Intergenic
1117110822 14:52452559-52452581 GGTTCCAAGAACATACATTGGGG + Intronic
1117124331 14:52604822-52604844 GATGCCCAGAACATACACTGGGG - Intronic
1117125179 14:52615218-52615240 GGTGCCAAGAACATACACTGGGG - Intronic
1117306809 14:54485876-54485898 GATGCCAAAAACATACACTGGGG + Intronic
1117323808 14:54650065-54650087 GAATTCAAGAAAATACGCTCTGG - Intronic
1118114191 14:62756676-62756698 GATGCCAAGAACATACAATGAGG + Intronic
1118146830 14:63146470-63146492 GTTTCCAAGAACATACATTGAGG - Intergenic
1118430455 14:65714134-65714156 GGTGCCAAGAATATACACTGAGG - Intronic
1118957317 14:70494659-70494681 GATGCCAGGAACATACACTGGGG + Intergenic
1120107233 14:80509889-80509911 GTTTCCAAGAACATACATTGGGG - Intronic
1120237996 14:81915366-81915388 GGCCCCAAGAAAATACACTGGGG + Intergenic
1120255387 14:82112586-82112608 GGCACCAAGAACATACACTGGGG - Intergenic
1121375931 14:93410804-93410826 GATGCCCAGGAAATACACTGTGG + Intronic
1121892737 14:97611176-97611198 GACTCCAAGAGCATACACTGGGG - Intergenic
1122148883 14:99713025-99713047 GGCACCAAGAACATACACTGGGG + Intronic
1122761231 14:104028944-104028966 GGCTCCAAGAACATTCATTGGGG - Intronic
1202832232 14_GL000009v2_random:47811-47833 CATTCCAAGAACATACGCTGGGG - Intergenic
1123685445 15:22793833-22793855 GCCAGCAAGAACATACACTGGGG - Intronic
1124273758 15:28307817-28307839 GGTACCAAGAACATACACTGGGG - Intronic
1124782964 15:32653454-32653476 ACTTCCATGAAAATACACTGGGG - Intronic
1125059754 15:35404988-35405010 GATGCCAAGAACATACATTGGGG - Intronic
1125124492 15:36203881-36203903 GATGCCAAGAACATACAGTGGGG + Intergenic
1125561480 15:40637058-40637080 GATCCCAAGAAAACAAACTGGGG - Intronic
1125977184 15:43965017-43965039 GTCTCCAAAAAAGTATACTGAGG + Intronic
1126659618 15:51020006-51020028 GACTGCAACAATAGACACTGAGG - Intergenic
1126991623 15:54384385-54384407 GATTCCAGGAACATACACTGGGG + Intronic
1127013179 15:54652638-54652660 GATGCCAAGAACATACACTAGGG + Intergenic
1127188329 15:56504757-56504779 GGCACCAAGAACATACAGTGGGG + Intergenic
1127680357 15:61289773-61289795 GATGTCAAGAAAATACACTAGGG + Intergenic
1127765315 15:62180211-62180233 GGCACCAAGAACATACACTGGGG + Intergenic
1128008314 15:64266740-64266762 GATGCCAAGAATATACACTGGGG + Intronic
1129193194 15:73949471-73949493 GACTCCAAAACAATATACTTTGG - Exonic
1129551857 15:76459935-76459957 GATGCCAAGAACATACACTGGGG - Intronic
1129562195 15:76582826-76582848 GTCACCAAGAATATACATTGAGG + Intronic
1129963102 15:79706986-79707008 GGCACCTAGAACATACACTGGGG - Intergenic
1130692724 15:86098577-86098599 GGTACCAAGAACATACACTGGGG - Intergenic
1131415615 15:92253888-92253910 GATGCCAAGAACCTACACTGGGG - Intergenic
1131430693 15:92386217-92386239 GATTCAAAGAAAATACGCGGTGG - Intergenic
1133256201 16:4517952-4517974 GACTCCCAGAAAATGCTCTCTGG + Intronic
1134235853 16:12465475-12465497 GCCACCAAGAAAACACAATGGGG - Intronic
1134240866 16:12505381-12505403 GATGCCAAGAAAATTCAATGTGG - Intronic
1134899146 16:17919258-17919280 GAATCCAAGAATATACAATGGGG + Intergenic
1135237594 16:20772623-20772645 GGTGCCAAGAACATACACTGAGG - Intronic
1135625941 16:23995065-23995087 GACCCCTAGAAATTTCACTGAGG - Intronic
1136668435 16:31835875-31835897 GTTGGCAAGAAAATACACTGAGG + Intergenic
1136733112 16:32437356-32437378 AACTCTTAGAAAATACACTCTGG + Intergenic
1137063471 16:35812752-35812774 GACTCCAGGAAGATACACTATGG + Intergenic
1137226932 16:46521924-46521946 GGCACCAAGAACATACCCTGGGG - Intergenic
1138315418 16:56065468-56065490 GACTCTAAGCAAAGGCACTGGGG - Intergenic
1138841369 16:60511753-60511775 GACTCCAGGAAAATCCATTAGGG + Intergenic
1138841935 16:60520611-60520633 GGCTCCAATAATATACACTGGGG + Intergenic
1138844626 16:60550485-60550507 GATGCCAAGAACATACACTGGGG - Intergenic
1138865028 16:60807604-60807626 GGTGCCAAGAACATACACTGGGG + Intergenic
1138916846 16:61474877-61474899 GATGCCAAGAATGTACACTGGGG + Intergenic
1139044815 16:63044042-63044064 GACAGCAAGAACATACACTGAGG - Intergenic
1139158392 16:64472855-64472877 GTTGCCAAGAACATACACTGAGG + Intergenic
1141462435 16:84185567-84185589 GCCTCCCAGAAAATGCACTAGGG + Intronic
1141924355 16:87157778-87157800 GGTGCCAAGAACATACACTGGGG + Intronic
1141995270 16:87633138-87633160 AACTGCAAGGAAATAAACTGTGG - Intronic
1203019971 16_KI270728v1_random:392247-392269 AACTCTTAGAAAATACACTCTGG - Intergenic
1203038306 16_KI270728v1_random:665405-665427 AACTCTTAGAAAATACACTCTGG - Intergenic
1143958028 17:10689924-10689946 GACACCAAAAACATACGCTGGGG + Intronic
1144322774 17:14146373-14146395 GGTGCCAAGAACATACACTGGGG + Intronic
1145027606 17:19480369-19480391 GATGCCAAGAAAACACAGTGAGG - Intergenic
1146750117 17:35371197-35371219 GATGCCAAGAACATACACTAGGG + Intronic
1147506240 17:41020331-41020353 GACTTCAAGAAACTTCATTGAGG + Intergenic
1149108938 17:53002941-53002963 AATGCCAAGAACATACACTGGGG + Intergenic
1149177254 17:53888075-53888097 GATGCCAAGAATATACAATGGGG + Intergenic
1149240880 17:54647464-54647486 GATGCCAAGAACATACATTGGGG + Intergenic
1149427035 17:56565238-56565260 GACCCCAAGAAATTTCACTGGGG - Intergenic
1149454041 17:56772961-56772983 GACTCCAAGTAAATAGTCCGTGG + Intergenic
1149648471 17:58258406-58258428 GATGCCAAGAACATATACTGGGG - Intronic
1149931248 17:60758019-60758041 GACTCCAAGAATATACACAAGGG - Intronic
1150000575 17:61434936-61434958 GACACCAAGAATACACAATGGGG - Intergenic
1150451767 17:65274844-65274866 GACGCCAAGACAATTCAATGGGG + Intergenic
1152204234 17:78965829-78965851 GTCTCCTAGAAAATTCCCTGCGG + Intergenic
1153440531 18:5113259-5113281 GGCACCAAGAAAATGCATTGGGG - Intergenic
1153557010 18:6325217-6325239 GAATCTGAGAAAATAAACTGTGG + Intronic
1154053382 18:10985449-10985471 GGCTCCAAGAATACACAATGGGG - Intronic
1154085481 18:11300986-11301008 GGTTCCTAGAACATACACTGGGG - Intergenic
1154231236 18:12557895-12557917 GTTGCCAAGAATATACACTGGGG + Intronic
1155443866 18:25890240-25890262 GGAGCCAAGAACATACACTGGGG + Intergenic
1155981817 18:32188294-32188316 GATGCCAAGAACTTACACTGGGG - Intronic
1156003792 18:32416599-32416621 GGTTCCAAGAAAATACACTGGGG + Intronic
1156094642 18:33514615-33514637 GGTTCCAAGAATATACATTGGGG + Intergenic
1156712630 18:39965243-39965265 GACTGCAAGAAAAAACACTTAGG - Intergenic
1157143835 18:45140247-45140269 GGCACCAAGAACATACATTGGGG - Intergenic
1157538499 18:48480500-48480522 GACACCAAAAACATACATTGGGG + Intergenic
1157846153 18:51005771-51005793 GAGTCCTAGAAATTTCACTGAGG - Intronic
1158881950 18:61788347-61788369 GGTGCCAAGAACATACACTGGGG - Intergenic
1158913868 18:62099690-62099712 GGCACCAAGAACATACATTGAGG + Intronic
1158948606 18:62470068-62470090 GGTGCCAAGAACATACACTGCGG - Intergenic
1159478548 18:68957377-68957399 GGCACCAAGAACATACATTGGGG - Intronic
1159895830 18:73995319-73995341 CATGCCAAGAAAATACACTGGGG - Intergenic
1159996097 18:74966428-74966450 GGTTCCAAGAACATTCACTGTGG - Intronic
1160092397 18:75839576-75839598 GACACCTAGAAATTTCACTGAGG - Intergenic
1160303470 18:77707711-77707733 GATGCCAAGAACATACAATGAGG + Intergenic
1160750309 19:730997-731019 GTCTCAAAAAAAAGACACTGGGG + Intronic
1161841771 19:6686043-6686065 GCCTCCTAGAGAAGACACTGAGG - Intronic
1162666157 19:12213989-12214011 GGTGCCAAGAACATACACTGGGG - Intergenic
1163208067 19:15818661-15818683 GATGCCAAGAACATACACTGGGG - Intergenic
1164336065 19:24322580-24322602 GACTCCAAGAAAATAATTAGTGG - Intergenic
1164484138 19:28640401-28640423 GACTCTCAGTAAATGCACTGAGG - Intergenic
1165017858 19:32896345-32896367 GGCACCAAGAACATACGCTGGGG + Intronic
1167775490 19:51551897-51551919 GGCTCCAAGAAAAGCAACTGGGG - Intergenic
1167838095 19:52091562-52091584 GGCACCAAGAATATACAATGAGG + Intronic
1167951469 19:53031177-53031199 GACCCCTAGAAATTTCACTGAGG - Intergenic
925021350 2:571522-571544 GATGCCAAGAACATACACTGGGG + Intergenic
925068053 2:944750-944772 GACACCAAGAACACACAGTGGGG - Intergenic
925087452 2:1119511-1119533 GACATCAAGAACATAAACTGTGG + Intronic
926455570 2:13063935-13063957 GGTACCAAGAACATACACTGAGG - Intergenic
926882124 2:17557558-17557580 GACTCCAGGAAAATCCACTGAGG + Intronic
927101177 2:19788925-19788947 GACTCCAAGAAATACCACTGGGG + Intergenic
927403160 2:22737377-22737399 GGCACCAAGAATACACACTGGGG + Intergenic
927420717 2:22927493-22927515 GACTCCAAGACAAACCTCTGTGG + Intergenic
927615271 2:24587652-24587674 GACCCAAAGAAAATACAGTAAGG - Intronic
927660362 2:24988224-24988246 GACTCCTAGAAATTTTACTGAGG - Intergenic
929084139 2:38151351-38151373 GGTGCCAAGAACATACACTGGGG + Intergenic
929212445 2:39372664-39372686 GATACCAAGAACATACACTGGGG + Intronic
929973185 2:46603583-46603605 GATGCCAAGAACATACACCGGGG + Intronic
930294824 2:49542144-49542166 GGTGCCAAGAACATACACTGGGG + Intergenic
930461667 2:51687124-51687146 GACACCAAGAACACACAATGGGG + Intergenic
930588230 2:53295813-53295835 GATGCCAAGAGCATACACTGAGG + Intergenic
930852258 2:55973637-55973659 GACCCCTAGAAATTTCACTGAGG + Intergenic
931453971 2:62392575-62392597 GATGCCAATAACATACACTGGGG - Intergenic
931552170 2:63458955-63458977 GCCCTCAAGAACATACACTGGGG + Intronic
931574040 2:63700746-63700768 GACACCAAGCACATACAATGGGG + Intronic
932377807 2:71253646-71253668 GCCTCAAAGAATATACTCTGAGG + Intergenic
932859154 2:75270736-75270758 GGCACCAAGAACATATACTGGGG - Intergenic
932957341 2:76368274-76368296 TACTTCAAGAAAACACACTACGG - Intergenic
933099025 2:78226705-78226727 GATGCCAAGAACATACATTGAGG - Intergenic
933348695 2:81125134-81125156 GGTGCCAAGAACATACACTGGGG - Intergenic
933458084 2:82542339-82542361 GTCTCCAAGAACAGGCACTGAGG + Intergenic
933481848 2:82868112-82868134 GACTCCCACAAAATCCACAGGGG + Intergenic
933617740 2:84500295-84500317 GATGCCAAGAACATACACTGGGG - Intergenic
933785314 2:85836007-85836029 GGCACCAAGAACATACAATGGGG + Intergenic
933819443 2:86096650-86096672 GGTGCCAAGAACATACACTGGGG + Intronic
934496014 2:94799931-94799953 GGTGCCAAGAACATACACTGGGG + Intergenic
934996790 2:98969672-98969694 GACACCAAAAACATACACTGGGG - Intergenic
935134436 2:100287492-100287514 GTCTCTAGGAAACTACACTGAGG - Intronic
935273307 2:101453603-101453625 GACTGGAAGAAATTACATTGAGG - Intronic
935841848 2:107121805-107121827 TTCTCCAATAAAATACAATGAGG - Intergenic
935845138 2:107157748-107157770 GACATTAAGAACATACACTGGGG - Intergenic
936031696 2:109077115-109077137 GACCCCAAGAATACACAATGGGG + Intergenic
936803876 2:116301369-116301391 GGCACCAAGAACATACAATGGGG + Intergenic
936939335 2:117867652-117867674 GGTTCAAAGAACATACACTGGGG - Intergenic
937116700 2:119410682-119410704 GTTTCCAAGAACATACATTGGGG - Intergenic
937194424 2:120139058-120139080 GGTGCCAAGAACATACACTGGGG + Intronic
937613066 2:123886760-123886782 GGTGCCAAGAATATACACTGGGG - Intergenic
937618032 2:123949999-123950021 GGTTCTAAGAACATACACTGGGG + Intergenic
937772815 2:125741326-125741348 AGCGCCAAGAACATACACTGAGG + Intergenic
937852629 2:126649150-126649172 GACTCCAAGAAATTTTACTGAGG + Intergenic
938375483 2:130802916-130802938 GACCCCCAGAAATTTCACTGAGG - Intergenic
938505080 2:131871481-131871503 GACATCAAGAACATACATTGAGG - Intergenic
938997732 2:136698435-136698457 TACTTCAAAAAAATACTCTGGGG + Intergenic
939213800 2:139211802-139211824 GACCCCTAGAAAATTTACTGAGG - Intergenic
939241569 2:139567537-139567559 GGTTCCAAGAACATACACTGGGG + Intergenic
940074309 2:149723499-149723521 GTCTCCATGTAAATAAACTGAGG + Intergenic
940750536 2:157622492-157622514 GGTGCCAAGAACATACACTGGGG + Intronic
941250176 2:163151673-163151695 GACTAAAGGAAAACACACTGAGG - Intergenic
941467674 2:165849233-165849255 GGCTCCAAGAACACACATTGGGG - Intergenic
941638987 2:167967321-167967343 GACACCAATAATATGCACTGAGG + Intronic
942000417 2:171640948-171640970 GGTGCCAAGAACATACACTGGGG - Intergenic
942886070 2:180925672-180925694 GTATCCAAGAAAAATCACTGAGG + Intergenic
943164064 2:184295045-184295067 GAATCAAAGAAAACACAATGGGG - Intergenic
943194159 2:184720971-184720993 GGTGCCAAGAACATACACTGAGG + Intronic
943281329 2:185937446-185937468 GGCACCAAGAACATACACTGGGG - Intergenic
944156788 2:196615976-196615998 GACATCAAGAACATACAATGGGG - Intergenic
944361170 2:198858988-198859010 GGTGCCAAGAACATACACTGAGG + Intergenic
944377440 2:199063338-199063360 GATGCCAAGACCATACACTGGGG + Intergenic
944438663 2:199719304-199719326 GTCAACAAGAATATACACTGGGG - Intergenic
944616071 2:201461946-201461968 GAAGCCAAGAACATACACTGGGG - Intronic
944625861 2:201568143-201568165 GACCCCTAGAAATTTCACTGAGG + Intronic
944919123 2:204392331-204392353 GGCACCAAGAACATACATTGGGG - Intergenic
944990202 2:205226623-205226645 TAAGCCAAGAACATACACTGGGG - Intronic
945031449 2:205667805-205667827 GATGCCAAGAACATAAACTGGGG - Intergenic
945099558 2:206251562-206251584 GACTCCAAGACAAAAGACTGGGG - Intergenic
945824514 2:214704511-214704533 GGCACCAAGAACATACAATGTGG + Intergenic
945866023 2:215176892-215176914 GGCACCAAGAACATACACTGGGG - Intergenic
946072756 2:217048542-217048564 GACTGCAAGAAAAGACACCATGG - Intergenic
946234307 2:218313464-218313486 GACTAGAAAAAAAGACACTGGGG - Intronic
946589889 2:221233809-221233831 GGTGCCAAGAACATACACTGGGG - Intergenic
946867035 2:224050688-224050710 GTCTCCAAGAGCATACATTGGGG - Intergenic
947130564 2:226919587-226919609 GGTGCCAAGAGAATACACTGGGG - Intronic
947247708 2:228068569-228068591 GGTGCCAAGAACATACACTGGGG + Intronic
947660621 2:231863920-231863942 GACTTCGAGAAAATAGACTGTGG + Intergenic
947869087 2:233422553-233422575 GACGCCAAGAAAATATTATGTGG - Intronic
948052317 2:234988060-234988082 GACTCAAAGAAAAAAAAATGTGG - Intronic
948980011 2:241489588-241489610 GATTCAAAGAAAACCCACTGTGG - Intronic
1168735186 20:129129-129151 GGCACCAAGAACATCCACTGGGG - Intergenic
1168737661 20:157042-157064 AGCACCAAGAACATACACTGGGG - Intergenic
1169736099 20:8839191-8839213 GACTCCTAGGAATTTCACTGAGG - Intronic
1169821231 20:9712744-9712766 GGCTCCAAGAACATACATTGAGG + Intronic
1170031187 20:11946100-11946122 GATTCCAAGAAAACTCTCTGGGG + Intergenic
1170306088 20:14939354-14939376 GCCACCAAGAACATACAATGAGG - Intronic
1170996879 20:21370120-21370142 GGAACCAAGAACATACACTGAGG - Intronic
1172190608 20:33059870-33059892 GGCTGCAAGAAAGGACACTGGGG - Exonic
1172900797 20:38333160-38333182 AAGTCCATGAAAATACAGTGAGG - Intronic
1173767435 20:45625729-45625751 GATGCCAAGAACATTCACTGGGG - Intronic
1173776391 20:45711234-45711256 GGCACCAAGAATATACAATGGGG + Intergenic
1174691251 20:52508449-52508471 GGTGCCAAGAATATACACTGGGG + Intergenic
1175434725 20:58936580-58936602 GATGCCAAGAACATACAATGGGG + Intergenic
1175573735 20:60043949-60043971 GACACCCAGAAAACACATTGGGG - Intergenic
1175680055 20:60979924-60979946 AATGCCAAGAACATACACTGGGG + Intergenic
1176788014 21:13282401-13282423 GACATCAAGAACATACATTGAGG + Intergenic
1176851360 21:13918758-13918780 CATGCCAAGAACATACACTGGGG + Intergenic
1176900168 21:14431486-14431508 GGCACCAAGAAGATACAATGAGG + Intergenic
1176999520 21:15594982-15595004 GGTGCCAAGAACATACACTGGGG + Intergenic
1177230277 21:18310961-18310983 GGCACCAAGAACATTCACTGGGG + Intronic
1177487685 21:21779952-21779974 GGTGCCAAGAACATACACTGGGG - Intergenic
1177578387 21:22988076-22988098 GCTGCCAAGAACATACACTGGGG + Intergenic
1177987153 21:27990587-27990609 GACATCAAGAACATACATTGAGG + Intergenic
1178004482 21:28202132-28202154 GGTGCCAAGAACATACACTGGGG + Intergenic
1178260227 21:31092931-31092953 GATGCCAAGAACATACATTGGGG - Intergenic
1179157980 21:38867070-38867092 GATTCCAAGAACATACAATAGGG + Intergenic
1179240423 21:39585252-39585274 GACATCAAGAACATACATTGAGG + Intronic
1179263781 21:39784000-39784022 GGTGCCAAGAACATACACTGGGG - Intronic
1180375906 22:12092974-12092996 GATTCCAAGAATATACATGGGGG - Intergenic
1180539348 22:16427738-16427760 AACTCTTAGAAAATACACTCTGG - Intergenic
1180597020 22:16983677-16983699 GATGCCAAGAGTATACACTGGGG + Intronic
1181912461 22:26250427-26250449 GGCACCAAGAACATTCACTGGGG - Intronic
1182402666 22:30092752-30092774 GTCACCAAGAACATACATTGGGG - Intronic
1183339202 22:37269516-37269538 GGCACCAAGAATATACACTGAGG + Intergenic
1184353696 22:43963700-43963722 TACTCCCAGAAAAAAGACTGTGG + Intronic
1185211228 22:49571659-49571681 GTCTCCAAGAAGAGCCACTGGGG - Intronic
949125730 3:443583-443605 GACTCCTAGAAATTTTACTGAGG + Intergenic
949235404 3:1802910-1802932 GATTCCAAGAACATACATTGGGG - Intergenic
949428324 3:3943549-3943571 TGCGCCAAGAACATACACTGGGG - Intronic
949452527 3:4202368-4202390 GGTGCCAAGAACATACACTGAGG - Intronic
949904423 3:8846984-8847006 CACTTAAAAAAAATACACTGTGG - Intronic
950339063 3:12225557-12225579 GATCCCAAGAACATACACTACGG + Intergenic
950722675 3:14895469-14895491 GGTTCCAAGAATATACACTGGGG - Intronic
951124873 3:18971555-18971577 GTTTCCAAGAACATACACTGGGG - Intergenic
951182266 3:19672327-19672349 GGTACCAAGAACATACACTGGGG + Intergenic
951204718 3:19913909-19913931 GGTGCCAAGAACATACACTGAGG + Intronic
951255463 3:20444487-20444509 GGTGCCAAGAAAATACGCTGGGG + Intergenic
951307980 3:21089141-21089163 GGCACCAAGAACATACAATGGGG + Intergenic
951434594 3:22647048-22647070 GGTGCCAAGAACATACACTGGGG - Intergenic
951654879 3:24994757-24994779 GACACAAAGAACATACAATGGGG - Intergenic
951929372 3:27946845-27946867 GGTGCCAAGAACATACACTGGGG - Intergenic
952120573 3:30238610-30238632 GACAACAAGAACATACACTGAGG - Intergenic
952132247 3:30378160-30378182 GTTGCCAAGAACATACACTGAGG - Intergenic
952475805 3:33709379-33709401 GACACCAAGAATACACAATGGGG - Intronic
952481509 3:33766609-33766631 GGTGCCAAGAAAATACATTGAGG + Intergenic
952587727 3:34912808-34912830 GAATCCTAGAAATTTCACTGAGG + Intergenic
952676316 3:36035122-36035144 GACACCAAGAACACACATTGGGG - Intergenic
952966177 3:38622605-38622627 GTCTCCAAGGAGACACACTGGGG + Intronic
953703005 3:45211133-45211155 GACTCCAGGAAAAACCACTTGGG + Intergenic
954511555 3:51130092-51130114 GACTCCTAGAAATTTTACTGAGG + Intronic
955249496 3:57264702-57264724 GGCACCAAGAATATACATTGGGG - Intronic
955377228 3:58408135-58408157 GGTTCCAAGAACATACAATGGGG - Intronic
955385913 3:58479805-58479827 GGCACCAAGAACATACATTGGGG - Intergenic
956237362 3:67088933-67088955 GGTGCCAAGAACATACACTGGGG + Intergenic
956306808 3:67835185-67835207 GACCCCTAGAAATTTCACTGAGG - Intergenic
956512757 3:70012427-70012449 GACTTGAAGATACTACACTGCGG + Intergenic
956676357 3:71736489-71736511 TACACCATGAAAATACATTGGGG + Intronic
956938425 3:74130651-74130673 GGTGCCAAGAACATACACTGGGG + Intergenic
957485944 3:80863224-80863246 GGTGCCAAGAACATACACTGGGG + Intergenic
957692050 3:83583540-83583562 GCCTCCAAGAACATACCATGGGG - Intergenic
957995647 3:87686617-87686639 GGCTCCAAGAAAACACAATGGGG + Intergenic
958005603 3:87806893-87806915 GGTTCCAAGAACATACATTGGGG - Intergenic
958014483 3:87922783-87922805 TACTCCAAGAACATGCACTGGGG - Intergenic
958014506 3:87923031-87923053 TACTCCAAGAACATGCACTGGGG - Intergenic
958052095 3:88361808-88361830 GGCTATAAGAAAATACACAGAGG - Intergenic
958105391 3:89066217-89066239 GTATCCAAGAAAATACTCAGAGG - Intergenic
958138493 3:89528711-89528733 GAGGCCAAGAAAAGACACCGGGG - Intergenic
958631820 3:96694314-96694336 GATGCCAAGAAAATACGTTGAGG - Intergenic
958668751 3:97175161-97175183 GATGCTAAGAACATACACTGGGG - Intronic
958754612 3:98235557-98235579 GCTTCCAAGAACATACATTGGGG - Intergenic
958855664 3:99381697-99381719 GTCACCAAGAAAATACAGTGAGG + Intergenic
958934241 3:100240201-100240223 GACTCCTAGAAATTTTACTGAGG - Intergenic
959038675 3:101395401-101395423 GGTGCCAAGAACATACACTGGGG - Intronic
959195743 3:103179446-103179468 GATACCAAGAACATACATTGGGG + Intergenic
959492711 3:107010516-107010538 GAAGCCAAGAACACACACTGGGG + Intergenic
959547023 3:107608333-107608355 GGTACCAAGAACATACACTGGGG - Intronic
959601751 3:108194716-108194738 AACACCAAGAACATACATTGTGG + Intronic
959655776 3:108802999-108803021 GGCACCAAGAACATACAGTGGGG + Intergenic
960200985 3:114836226-114836248 GAATGCTAGAAAATCCACTGAGG - Intronic
960521031 3:118655354-118655376 GGTGCCAAGAACATACACTGAGG - Intergenic
960566434 3:119137446-119137468 GTTTCCAAGAACATACATTGCGG + Intronic
960646905 3:119895672-119895694 GATTCCAAGATAATTCAATGGGG - Intronic
961002607 3:123384182-123384204 GGCCCCAAGAAAAGACCCTGAGG + Intronic
961850731 3:129815476-129815498 GGCACCAAGAACATACAATGGGG + Intronic
961953608 3:130776199-130776221 GGCACCAAGAACATACATTGGGG + Intergenic
961967460 3:130920436-130920458 GATGCCAAGAATATACAATGAGG - Intronic
962305836 3:134285059-134285081 GATGTCAAGAACATACACTGGGG + Intergenic
962638438 3:137356416-137356438 GATGCCAAGAATATACATTGGGG - Intergenic
962822615 3:139066437-139066459 GCAACCAAGAACATACACTGAGG - Intronic
962823492 3:139076179-139076201 GCAACCAAGAACATACACTGAGG + Intronic
963096474 3:141546962-141546984 GGTGCCAAGAACATACACTGGGG - Intronic
963160157 3:142142828-142142850 GATGCCAAGAACACACACTGGGG + Intronic
963179816 3:142342659-142342681 GGCACCAAGAACATACATTGGGG + Intronic
963357441 3:144227375-144227397 GGCCTCAAGAACATACACTGGGG + Intergenic
963454892 3:145533310-145533332 GACCCCAAGCATAGACACTGGGG - Intergenic
963515630 3:146305212-146305234 GTTGCCAAGAATATACACTGGGG + Intergenic
963802761 3:149693720-149693742 GGTACCAAGAACATACACTGGGG + Intronic
963818457 3:149860496-149860518 GGTGCCAAGAACATACACTGGGG + Intronic
963858605 3:150282761-150282783 GGTGCCAAGAACATACACTGGGG + Intergenic
964262893 3:154859992-154860014 GGTGCCAAGAACATACACTGGGG - Intergenic
964537560 3:157740185-157740207 GGTGCCAAGAACATACACTGGGG - Intergenic
964788195 3:160422911-160422933 GATGCCAAGAAAATTCAATGGGG - Intronic
964936206 3:162091343-162091365 TACTACAAAAAAAAACACTGGGG - Intergenic
965462489 3:168984502-168984524 GACACCAAGAACATACATTGGGG + Intergenic
965629713 3:170720033-170720055 GGGTCCAAGAACATACATTGAGG + Intronic
965908280 3:173738507-173738529 GGTTCCAAGAAAATGCATTGGGG - Intronic
965940397 3:174172581-174172603 GGTGCCAAGAACATACACTGGGG - Intronic
966054140 3:175661757-175661779 GGCACCAAGAACATACAATGGGG - Intronic
966226311 3:177601857-177601879 GACTTCAAAAAAATACACTGAGG - Intergenic
966459306 3:180157911-180157933 GGCACCAAGAACATGCACTGGGG - Intergenic
967632711 3:191764811-191764833 GCTGCCAAGAACATACACTGGGG - Intergenic
967655918 3:192048594-192048616 GGTGCCAAGAACATACACTGGGG + Intergenic
967677932 3:192322726-192322748 GTTTCCAAGAACATACATTGGGG + Intronic
968004459 3:195230644-195230666 GGTTCCAAGAACATACACTGGGG - Intronic
968470048 4:776136-776158 AAATCCAAGAAAATCCCCTGAGG - Intergenic
968719516 4:2190284-2190306 GGCTCCAAGAATATATATTGGGG + Intronic
969429728 4:7147108-7147130 GGCTCCGAGAAATTCCACTGCGG - Intergenic
970498381 4:16651548-16651570 GGGTCCAAGAAAATCAACTGAGG - Intronic
970753189 4:19391175-19391197 GGCACCAATAAAATACATTGGGG + Intergenic
971906259 4:32730278-32730300 GGCACCAAGAACATACACTGAGG - Intergenic
972207616 4:36797037-36797059 TACACCAAGAACATACATTGGGG + Intergenic
972225889 4:37011405-37011427 GATGCCAAGAACATACACTGGGG + Intergenic
972271874 4:37519033-37519055 GGTGCCAAGAACATACACTGGGG - Intronic
972277986 4:37575863-37575885 GGAACCAAGAACATACACTGGGG - Intronic
972328354 4:38039778-38039800 GACTGCAATAGAATTCACTGTGG + Intronic
972415628 4:38837453-38837475 GATGCCAACAACATACACTGGGG + Intronic
972737550 4:41858964-41858986 GACTCCTCTAAAATCCACTGCGG + Intergenic
972858622 4:43139128-43139150 GAGACCAAGAACATACATTGGGG - Intergenic
972920553 4:43935962-43935984 GACACCAAAAATTTACACTGGGG + Intergenic
972927435 4:44028391-44028413 GGCAACAAGAACATACACTGAGG + Intergenic
972993782 4:44853632-44853654 GGCACCAAGAGCATACACTGGGG - Intergenic
973143629 4:46798170-46798192 GACTCCTAGAAATTTCACTGAGG - Intronic
973227614 4:47803582-47803604 GATGCCAAGAACATACATTGCGG + Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
973901415 4:55476619-55476641 GACACTAAGAAAAATCACTGTGG - Intronic
973949908 4:56001521-56001543 GATGCCAAGAACATACAATGGGG - Intronic
973967248 4:56176042-56176064 GGCACCAAGAACACACACTGGGG - Intronic
974663899 4:64932953-64932975 GGTGCCAAGAACATACACTGGGG - Intergenic
974675349 4:65080664-65080686 AGCTCCAAGAAAATACATTGTGG + Intergenic
974677118 4:65106589-65106611 GACACCAAGAATATACATTAGGG + Intergenic
974784504 4:66600846-66600868 GACACCAAGAAAATACATTGGGG + Intergenic
974905911 4:68056914-68056936 GATGCCAAGAATACACACTGAGG + Intronic
975024412 4:69531195-69531217 GACCCTAAGAAACTTCACTGAGG - Intergenic
975053989 4:69904791-69904813 GGTACCAAGAATATACACTGGGG + Intergenic
975070075 4:70123992-70124014 GGCACCAAGAAAACACAGTGGGG + Intergenic
975335668 4:73172183-73172205 GACACAAATAAAATACAATGGGG + Intronic
975364518 4:73513387-73513409 GGTGCCAAGAACATACACTGGGG - Intergenic
975375637 4:73641171-73641193 GGTTCCAAGAACATACATTGGGG - Intergenic
975418000 4:74128481-74128503 GACACCAAGAATAGACAATGGGG - Intronic
975674765 4:76815368-76815390 GGTGCCAAGAACATACACTGGGG - Intergenic
976525693 4:86084974-86084996 GGTGCCAAGAACATACACTGGGG + Intronic
977033611 4:91920470-91920492 GGCACCAAGAACATACAATGGGG - Intergenic
977044890 4:92056977-92056999 GGTGCCAAGAACATACACTGGGG + Intergenic
977166549 4:93705944-93705966 GGTGCCAAGAACATACACTGAGG - Intronic
977641778 4:99365489-99365511 GGCACCAAGAACATACATTGAGG - Intergenic
977773254 4:100884607-100884629 AATTCCAAGAACGTACACTGTGG - Intergenic
977944806 4:102899914-102899936 AACTCTTAGAAAATACACTCTGG - Intronic
977970989 4:103214168-103214190 GGTGCCAAGAACATACACTGGGG + Intergenic
978571813 4:110146216-110146238 GTCAACAAGAACATACACTGAGG + Intronic
978623806 4:110661970-110661992 GTCTCCCAGAAAATGGACTGAGG + Intergenic
978674437 4:111293974-111293996 GTTGCCAAGAACATACACTGGGG + Intergenic
978922054 4:114195964-114195986 GTTGCCAAGAACATACACTGAGG - Intergenic
978974711 4:114855538-114855560 GATGTCAAGAACATACACTGGGG - Intronic
979050563 4:115925457-115925479 CACACCAAGAACATACTCTGGGG + Intergenic
979180788 4:117723776-117723798 GACACCAAGAACACACACTGGGG + Intergenic
979430674 4:120625793-120625815 GATGCCAAGAATATACAATGGGG + Intergenic
979564596 4:122139967-122139989 GTTGCCAAGAATATACACTGGGG - Intergenic
979594528 4:122519629-122519651 GGTTCCAAGAACATACACTGGGG - Intergenic
979651234 4:123134366-123134388 GATGCCAAGAACATACAATGGGG - Intronic
979771442 4:124529952-124529974 TACTCCATGAAAAGTCACTGAGG + Intergenic
979847179 4:125530308-125530330 GTCACCAAGAACATACATTGAGG + Intergenic
979879382 4:125935808-125935830 AATGCCAAGAACATACACTGGGG + Intergenic
979883168 4:125988190-125988212 GACCCCATGAAGATACATTGTGG + Intergenic
979888622 4:126062610-126062632 GACACCTAGAAATTTCACTGAGG + Intergenic
980407359 4:132370281-132370303 GGCAACAAGAACATACACTGGGG - Intergenic
980683186 4:136190338-136190360 GATGCCAAGAACATACATTGTGG + Intergenic
980687601 4:136250128-136250150 TACTATAAAAAAATACACTGAGG - Intergenic
981556167 4:145997306-145997328 GACACCAAGAACATACACTAGGG - Intergenic
981896473 4:149807304-149807326 AACTCCAAGAACATACACTGGGG + Intergenic
982318252 4:154053115-154053137 GTCACCAAGAACATGCACTGGGG - Intergenic
982999478 4:162395711-162395733 GTCAACAAGAACATACACTGGGG + Intergenic
983005566 4:162480390-162480412 GAGTAAAACAAAATACACTGAGG + Intergenic
983023076 4:162703312-162703334 GATTCCAAGAACATATAGTGGGG + Intergenic
983138904 4:164123675-164123697 GATGCCAAGAACATACACTGGGG + Intronic
983757926 4:171364853-171364875 GGCACCAAGAACTTACACTGGGG - Intergenic
984172312 4:176374252-176374274 GTCTGCAAAAATATACACTGGGG + Intergenic
984470095 4:180158196-180158218 AACTCCAAGAACACACATTGGGG + Intergenic
985098910 4:186438058-186438080 GGTGCCAAGAACATACACTGGGG + Intronic
985145126 4:186888884-186888906 GACTCCAAGAAAGTGGACTGGGG + Intergenic
985176272 4:187205821-187205843 GAATCTAAAAAAATACAGTGAGG + Intergenic
1202757504 4_GL000008v2_random:78414-78436 GATTCCAAGAATATACATGGGGG - Intergenic
986261659 5:6152672-6152694 GACTCCTAGAAATTTTACTGAGG + Intergenic
986553669 5:8987367-8987389 GGTACCAAGAAAATACACTGGGG - Intergenic
987153114 5:15061237-15061259 GACTCCTAGAAATTTTACTGAGG - Intergenic
987161279 5:15146100-15146122 GTTTCCAAGAACATTCACTGGGG + Intergenic
987518783 5:18951485-18951507 GACTTCAAAAACATACACTGGGG + Intergenic
987643271 5:20638494-20638516 GGCACCAAGAACATGCACTGAGG + Intergenic
987681991 5:21147770-21147792 GATGCCAAGAATATACACTGGGG - Intergenic
988051984 5:26042396-26042418 GAGTCCATGACAAAACACTGAGG - Intergenic
988762121 5:34321496-34321518 TAATGCAAGAAAATCCACTGAGG - Intergenic
988939793 5:36132182-36132204 GGCTCCTAGAACATACAATGAGG + Intronic
989074449 5:37548906-37548928 GGTGCCAAGAACATACACTGAGG - Intronic
989111514 5:37911130-37911152 GGTGCCAAGAACATACACTGGGG + Intergenic
989234432 5:39129185-39129207 GGCACCAAGAACATACACTGGGG + Intronic
989457713 5:41662206-41662228 GACTCCTAGAAATTTTACTGAGG + Intergenic
989553656 5:42765640-42765662 GGTGCCAAGAACATACACTGGGG + Intronic
989629940 5:43471669-43471691 GGTGCCAAGAACATACACTGGGG + Intronic
989663310 5:43823641-43823663 GGTGCCAAGAACATACACTGGGG - Intergenic
989786190 5:45333750-45333772 GATGTCAAGAAAATATACTGGGG - Intronic
990204755 5:53416636-53416658 GACTAGAAGAAAATATATTGTGG - Intergenic
990891085 5:60651082-60651104 TACTGCAAGGAAATAAACTGAGG + Intronic
990922376 5:60981830-60981852 GATGCCAAGAACATACAGTGAGG + Intronic
991537190 5:67682925-67682947 GATGCCAAGAACATATACTGAGG - Intergenic
991701702 5:69322409-69322431 GGATCCAAGGAAATACACAGGGG - Intronic
992224155 5:74602974-74602996 GGCACCAAGAAAACACACTGAGG + Intergenic
992725145 5:79599003-79599025 GGTGCCAAGAACATACACTGGGG - Intergenic
992840346 5:80683948-80683970 GGTGCCAAGAACATACACTGAGG - Intronic
993228319 5:85199192-85199214 GGCCCCAAGAACATACATTGAGG - Intergenic
993331092 5:86600976-86600998 GATGCCAAGAACATACACTGGGG + Intergenic
993345701 5:86779557-86779579 GGCACCAAGAATATATACTGGGG - Intergenic
993472056 5:88318235-88318257 GACACCAAGAACATACATTAGGG - Intergenic
993913529 5:93712932-93712954 GGTGCCAAGAACATACACTGGGG + Intronic
993941955 5:94069166-94069188 GGCACCAAGACTATACACTGGGG + Intronic
994130496 5:96221985-96222007 GGTGCCAAGAACATACACTGGGG + Intergenic
994159826 5:96545043-96545065 TTCTCCAAGAAAATACACCTTGG + Intronic
994221476 5:97200669-97200691 GATTCCAAGAAAATTCAGTTGGG + Intergenic
994259082 5:97635424-97635446 GACACCAAGAAAAAACACTATGG - Intergenic
994629425 5:102265574-102265596 GATACCAAGGATATACACTGGGG - Intronic
994690440 5:103012528-103012550 GTTTCCAAGAACATACACTGGGG - Intronic
994866276 5:105275896-105275918 GGCCCCAAGAACATACACTGGGG + Intergenic
995116753 5:108489614-108489636 GACACCAAGAACATACACTTGGG + Intergenic
995213286 5:109565451-109565473 GACATCAAGAACATACATTGGGG - Intergenic
995262303 5:110118887-110118909 GATGCCAAGAAAATACATGGGGG - Intergenic
995693263 5:114851055-114851077 GGCACCAAGAACATACACTAGGG + Intergenic
995785905 5:115827328-115827350 GACACTAAGAACATACATTGGGG - Intergenic
996047833 5:118895740-118895762 GGCACCAAGAACATACATTGGGG + Intronic
996222624 5:120952197-120952219 GATTCCAAGAACATACACTGGGG - Intergenic
996473916 5:123893307-123893329 GTCACCAAGAAAATACATTGGGG + Intergenic
996836486 5:127799187-127799209 GACTGCAAGATAATACATTCTGG + Intergenic
996908771 5:128632538-128632560 GACTCCTAGAAATTTCACTGAGG + Intronic
996927949 5:128851261-128851283 GGTGCCAAGAACATACACTGGGG + Intronic
997002496 5:129778633-129778655 GATGGCAAGAACATACACTGGGG + Intergenic
997096316 5:130917136-130917158 GGCACCAAGAACATACAATGGGG + Intergenic
997862441 5:137430219-137430241 AATTCCAAGTAAATACACTGTGG - Intronic
998010644 5:138692798-138692820 GGCACCAAGAATATACACTGGGG - Intronic
998058349 5:139098319-139098341 GGTGCCAAGAACATACACTGGGG + Intronic
998877589 5:146616110-146616132 GGTGCCAAGAACATACACTGGGG + Intronic
998938137 5:147252433-147252455 GACTACCAGAAAACCCACTGAGG - Intronic
999919168 5:156299204-156299226 GGTGCCAAGAACATACACTGGGG - Intronic
1000354686 5:160382822-160382844 GGCACCAAGAAAATAAACTTAGG + Intergenic
1000516192 5:162238459-162238481 GAAACCAAGAAAGTATACTGTGG - Intergenic
1000582665 5:163053102-163053124 GGCTCCAAGAATATACATGGAGG + Intergenic
1001969395 5:175941993-175942015 GATGCCAAGAAAATACACTGAGG + Intronic
1002120612 5:177001273-177001295 GTTGCCAAGAACATACACTGGGG - Intronic
1002248040 5:177901756-177901778 GATGCCAAGAAAATACACTGAGG - Intergenic
1002839226 6:891492-891514 GACACAGAGAAAAGACACTGGGG - Intergenic
1002867499 6:1135265-1135287 GAGTCCAAGAACATACACTGAGG - Intergenic
1002997896 6:2304312-2304334 GACTCCTAGAAATTTTACTGAGG - Intergenic
1003203140 6:3981525-3981547 GGCAAAAAGAAAATACACTGTGG - Intergenic
1003658486 6:8037853-8037875 GGCACCAAGAACATACAATGGGG + Intronic
1003803341 6:9696756-9696778 GATGCCAAGAAAACACAATGGGG + Intronic
1004612166 6:17252978-17253000 GTCAACAAGAACATACACTGGGG + Intergenic
1004704668 6:18113226-18113248 GGTTCCAAGAACATACATTGGGG + Intergenic
1005578071 6:27208562-27208584 GACACCTAGAAATTTCACTGAGG - Intergenic
1005872990 6:29990387-29990409 GGAACCAAGAATATACACTGGGG + Intergenic
1006619149 6:35350513-35350535 GGTGCCAAGAACATACACTGAGG - Intronic
1006724671 6:36189096-36189118 GAATCCAAGAAAAAAGAATGGGG - Intergenic
1008098400 6:47364294-47364316 GACTAAAAGATAATTCACTGAGG - Intergenic
1008249902 6:49226943-49226965 GGCGACAAGAACATACACTGAGG - Intergenic
1008255094 6:49288882-49288904 GGCACCAAGAACATACACTAAGG - Intergenic
1008858432 6:56119784-56119806 GATTCCGAGAACATACACTAGGG + Intronic
1008937406 6:57006954-57006976 AACACCAAGAACATTCACTGGGG + Intronic
1009245969 6:61237903-61237925 GGTGCCAAGAAAATACACTGGGG + Intergenic
1009561763 6:65255253-65255275 GATGCCAAAAATATACACTGGGG + Intronic
1009712236 6:67339243-67339265 GGCACCAAGAACATACATTGAGG + Intergenic
1009788262 6:68366207-68366229 GTTTCCAAGAACATACACCGGGG - Intergenic
1010018819 6:71136437-71136459 GGTTCCAAGAACATACAATGGGG + Intergenic
1010475244 6:76278662-76278684 GACACCAAGAACACACATTGAGG - Intergenic
1010481858 6:76364715-76364737 GGTGCCAAGAACATACACTGGGG - Intergenic
1010621436 6:78081356-78081378 GGCTCCAAGAACACACATTGAGG + Intergenic
1011024381 6:82851042-82851064 GGTGCCAAGAACATACACTGGGG + Intergenic
1011116801 6:83902284-83902306 GACGTCAAGAATATACAATGAGG - Intronic
1011123478 6:83980915-83980937 GGCTCCAAAAACATACATTGAGG - Intergenic
1011140969 6:84156105-84156127 GTCACCAAAAAAATACACTAGGG + Intronic
1011159747 6:84375777-84375799 GATGGCAAGAACATACACTGGGG - Intergenic
1011586836 6:88935192-88935214 GGCACCAAGAACATACATTGGGG - Intronic
1011779309 6:90769269-90769291 CACAGCAAGAAAATCCACTGAGG - Intergenic
1011901785 6:92307599-92307621 GATGTCAAGAACATACACTGGGG + Intergenic
1011916972 6:92518907-92518929 GATTCCAAGAATAAACAATGGGG + Intergenic
1011923116 6:92607044-92607066 GGTGCCAAGAACATACACTGGGG + Intergenic
1012512495 6:100019651-100019673 GGTGCCAAGAACATACACTGGGG + Intergenic
1012620263 6:101335722-101335744 GAAGCCAAGAACATGCACTGGGG - Intergenic
1012744705 6:103070972-103070994 GGTGCCAAGAACATACACTGGGG + Intergenic
1012791307 6:103700974-103700996 GATTCCAAAGAAATGCACTGAGG - Intergenic
1012800820 6:103825344-103825366 GATGCCAAGAATATACACTGGGG + Intergenic
1012806762 6:103904203-103904225 GATGCCAAGAACATACATTGGGG - Intergenic
1013398231 6:109765473-109765495 GACACCAAGAACATCCACTGGGG - Intronic
1013460063 6:110366204-110366226 GACTCCAAGGAAAAAGACTAGGG - Intergenic
1014093149 6:117428286-117428308 GATGCCAAGAACATACACTGGGG - Intronic
1014415633 6:121180475-121180497 GTTTCCAAGAACATACAGTGGGG + Intronic
1014549637 6:122775388-122775410 GGTGCCAAGAATATACACTGTGG + Intergenic
1014833948 6:126136860-126136882 GGCACCAAGAATATACGCTGGGG + Intergenic
1014862432 6:126485960-126485982 GACTACATGAAAATGCACAGAGG + Intergenic
1015668243 6:135656401-135656423 AACTACTAGAAAAAACACTGGGG - Intergenic
1015909355 6:138152441-138152463 GGTTCCAAGAACACACACTGGGG - Intergenic
1016132878 6:140498391-140498413 GACCCCTAGAAATTTCACTGAGG + Intergenic
1016368898 6:143350626-143350648 GGCACCAAGAACATACATTGGGG - Intergenic
1016601031 6:145860874-145860896 GATGCCAAGAATATACAATGAGG + Intergenic
1016642652 6:146367166-146367188 GACTCCAAGAAAATACACTGGGG - Intronic
1017509207 6:155097920-155097942 GGCACCAAGAATATACAATGGGG - Intronic
1018348090 6:162923620-162923642 GATGCCAAGAACATACATTGGGG - Intronic
1018600648 6:165536192-165536214 GACGCCAAGAACATACAATGAGG + Intronic
1019054220 6:169211011-169211033 GACATCAAGAACATACATTGGGG + Intergenic
1020483797 7:8695871-8695893 GACTCCATGAACATTCACTGGGG - Intronic
1020573438 7:9895760-9895782 GGTGCCAAGAACATACACTGGGG + Intergenic
1020840072 7:13205678-13205700 GGCACCAAGAACATACAATGGGG - Intergenic
1020949305 7:14654755-14654777 GGCTCTAAGAACATACACTGGGG + Intronic
1021519103 7:21520977-21520999 GAGTTCAAGAACATACAATGGGG + Intergenic
1021641389 7:22740911-22740933 GGTGCCAAGAACATACACTGGGG + Intergenic
1021741068 7:23686079-23686101 AACTCCAACTAAAAACACTGAGG + Intronic
1021752871 7:23821917-23821939 GGCACCAAGAACATATACTGGGG - Intronic
1022750098 7:33215372-33215394 GATGCCAAGAATATACAATGAGG + Intronic
1024149220 7:46552611-46552633 GACAAAGAGAAAATACACTGAGG + Intergenic
1024336177 7:48208059-48208081 GGCTCCAAGAACATTCAATGAGG - Intronic
1024411201 7:49044387-49044409 GTTGCCAAGAACATACACTGAGG + Intergenic
1024621945 7:51167799-51167821 GGTGCCAAGAACATACACTGGGG + Intronic
1024660784 7:51491968-51491990 GGTGCCAAGAACATACACTGGGG - Intergenic
1024663859 7:51526238-51526260 GACACAAAGAAAATACAATGGGG + Intergenic
1024744135 7:52388000-52388022 GACCCCTAGAAATTTCACTGAGG - Intergenic
1025037993 7:55611639-55611661 GACACCAAGAAGACACAATGGGG - Intergenic
1026388632 7:69877630-69877652 GACGGCAACAAAAGACACTGGGG - Intronic
1027628349 7:80571824-80571846 GGCACCAGGAACATACACTGGGG - Intronic
1028120039 7:87047064-87047086 GGTACCAAGAATATACACTGGGG + Intronic
1028266091 7:88727655-88727677 GGTGCCAAGAACATACACTGCGG - Intergenic
1028382901 7:90218532-90218554 GGCACCAAGAACATACACTGAGG - Intronic
1028398586 7:90399995-90400017 GGCACCAAGAACATACAATGGGG + Intronic
1028645260 7:93088404-93088426 GACACCAAGTACATACATTGGGG - Intergenic
1028671386 7:93404378-93404400 GACACCAAGAACATACACTGGGG - Intergenic
1028817874 7:95168269-95168291 GACACCAAGAACATACATTGGGG + Intronic
1029057170 7:97759014-97759036 GATTCCCAGAAAATACACTGAGG - Intergenic
1029314886 7:99702511-99702533 GTTTTCAAGAACATACACTGGGG - Intronic
1029352309 7:100022900-100022922 GACTCCAAGCAAACACCCTGAGG + Intronic
1030593887 7:111512828-111512850 GATGCCAAGAACATACAATGAGG + Intronic
1030599475 7:111577215-111577237 GGTGCCAAGAACATACACTGAGG + Intergenic
1030679256 7:112417384-112417406 GGTGCCAAGAATATACACTGGGG + Intergenic
1030794145 7:113766762-113766784 GGCACCAATAAAATACATTGGGG - Intergenic
1030868240 7:114725752-114725774 GCCAACAAGAACATACACTGGGG - Intergenic
1030981880 7:116195539-116195561 TACTCCAAGCTAATACACTCTGG - Intergenic
1031078505 7:117235857-117235879 GGTGCCAAGAACATACACTGGGG - Intergenic
1031231239 7:119109431-119109453 CATTCCAAGAACATACATTGGGG - Intergenic
1031472286 7:122181607-122181629 GGTTCCAAGAACATACAATGGGG - Intergenic
1031472699 7:122186063-122186085 GGTGCCAAGAACATACACTGGGG + Intergenic
1031737638 7:125386310-125386332 ACCTCCAACCAAATACACTGAGG - Intergenic
1031741488 7:125437292-125437314 GACGCAAAGAACATATACTGGGG - Intergenic
1031802262 7:126262504-126262526 GGTGCCAAGAACATACACTGGGG - Intergenic
1031825969 7:126565912-126565934 GATGCCAAGAATATACAATGGGG + Intronic
1031906151 7:127462050-127462072 GATCCCAAGAACATACACTGGGG + Intergenic
1032001570 7:128268768-128268790 GTTTCCAAGAACATACATTGAGG + Intergenic
1032822809 7:135540059-135540081 GTCACCAAGAACATACAATGGGG + Intergenic
1033380901 7:140817670-140817692 GGTGCCAAGAACATACACTGGGG + Intronic
1033614126 7:142995410-142995432 GACACCAAGAACATACACTGAGG + Intergenic
1033841627 7:145381425-145381447 GATGCCAAGAACATACACTGGGG - Intergenic
1034058493 7:148063290-148063312 GAATGGAAGAAACTACACTGAGG - Intronic
1036527401 8:9547951-9547973 GACCCCTAGAAACTTCACTGGGG + Intergenic
1037255886 8:16953049-16953071 GATGCCAACAACATACACTGGGG + Intergenic
1037277160 8:17192883-17192905 GATGCCAAGAACATACACTGGGG - Intronic
1037427835 8:18776110-18776132 GGCTCCAAGAACATACTTTGAGG - Intronic
1037461425 8:19114120-19114142 GATGCCAAGAACATGCACTGGGG - Intergenic
1037472757 8:19226788-19226810 GTCTTCATGAACATACACTGAGG - Intergenic
1037668255 8:20990958-20990980 GGTGCCAAGAACATACACTGGGG - Intergenic
1038723320 8:30057602-30057624 GACTCCTAGAAATTTCCCTGAGG + Intergenic
1039647070 8:39298285-39298307 GGTGCCAAGAACATACACTGAGG - Intergenic
1039663873 8:39498271-39498293 GTTTCCAAGAACATACACTGTGG + Intergenic
1039904556 8:41776555-41776577 GACTCCAAGAAAGGATAATGAGG + Intronic
1040048784 8:42991055-42991077 GATGCCAAGAACATACTCTGGGG - Intronic
1040100870 8:43502639-43502661 GATGCCAAGAACATACATTGGGG - Intergenic
1040510927 8:48093810-48093832 GGAGCCAAGAACATACACTGAGG - Intergenic
1040628338 8:49178344-49178366 AGCGCCAAGAACATACACTGAGG + Intergenic
1041744808 8:61197288-61197310 GGGGCCAAGAACATACACTGGGG - Intronic
1042069991 8:64921786-64921808 GATTCCAAGAATACACAATGTGG - Intergenic
1043092048 8:75916987-75917009 GGTGCCAAGAAAAAACACTGGGG - Intergenic
1043169106 8:76941682-76941704 GCCTCCAAGAACATACATGGGGG - Intergenic
1043269071 8:78306157-78306179 TACACCAAGAAAATACATTAGGG - Intergenic
1043281808 8:78477456-78477478 AACTTAAAGAAAATACATTGGGG - Intergenic
1043627392 8:82279091-82279113 GATGCCAAGAACATACACTGGGG + Intergenic
1044046523 8:87441583-87441605 GACACCAAGAACATACACTGGGG - Intronic
1044147995 8:88741458-88741480 GACTCCAAGAAAGTACTTTAGGG - Intergenic
1044192606 8:89336867-89336889 GCTGCCAAGAACATACACTGAGG - Intergenic
1044954365 8:97464284-97464306 GAGTCAAACAAAAGACACTGGGG + Intergenic
1044957454 8:97495955-97495977 GGTGCCAAGAACATACACTGGGG + Intergenic
1045127504 8:99108542-99108564 GGGGCCAAGAAAACACACTGAGG - Intronic
1045134216 8:99195825-99195847 GATGCCAAGAATATACAATGGGG - Intronic
1045662395 8:104451657-104451679 GACTCAAAGAAAACAGAGTGAGG + Intronic
1045731986 8:105252854-105252876 GGTGCCAAGAATATACACTGGGG - Intronic
1045777059 8:105817073-105817095 GGTGCCAAGAAAGTACACTGCGG - Intergenic
1046167115 8:110451491-110451513 GGTTCCAGGAACATACACTGGGG - Intergenic
1046335843 8:112786155-112786177 GATGCCAAGAACATACACTGGGG + Intronic
1046384769 8:113495068-113495090 GAATCCTAGAAATTTCACTGAGG - Intergenic
1046399787 8:113690192-113690214 GCCATCAAGAACATACACTGGGG - Intergenic
1046451939 8:114404638-114404660 GGCACCAAGAACATATACTGAGG + Intergenic
1047036550 8:120945522-120945544 GACACCAAGAACTTATACTGGGG - Intergenic
1047453570 8:124988904-124988926 GACCCCTAGAAATTTCACTGAGG - Intergenic
1047910563 8:129524222-129524244 GAGGCCAAGAACATACACTGGGG + Intergenic
1047981718 8:130190416-130190438 GGCACCAAGAACATACATTGGGG - Intronic
1048906106 8:139090759-139090781 GGTGCCAAGAACATACACTGGGG - Intergenic
1049011865 8:139892603-139892625 GTTTCCAAGAAAATAAACCGTGG - Intronic
1049489284 8:142885261-142885283 GATGCCAAGAACATACACAGGGG + Intronic
1050067470 9:1775495-1775517 GACTCCTAGAAACCTCACTGAGG + Intergenic
1050404190 9:5290628-5290650 CAAGCCATGAAAATACACTGAGG + Intergenic
1050751484 9:8943501-8943523 GGTGCCAAGAACATACACTGTGG + Intronic
1050759329 9:9047624-9047646 GATGCCAAGAACATATACTGGGG + Intronic
1051031997 9:12692344-12692366 GATACCAAGAACATACACTGGGG - Intronic
1051110106 9:13626066-13626088 GGCACCAAGAACATACACTTGGG - Intergenic
1051451049 9:17198000-17198022 GACACCAAGAATATACATTGGGG - Intronic
1051573633 9:18588721-18588743 GATCCCAAGAATATGCACTGGGG - Intronic
1051589634 9:18763749-18763771 GGTGCCAAGAACATACACTGGGG - Intronic
1051704746 9:19865576-19865598 GGTGCCAAGAACATACACTGGGG + Intergenic
1051793798 9:20839924-20839946 GATGCCAAGAACATACACTGGGG - Intronic
1052258287 9:26485133-26485155 GGTGCCAAGAACATACACTGGGG - Intergenic
1052259552 9:26497869-26497891 TATGCCAAGAACATACACTGTGG + Intergenic
1052450450 9:28623456-28623478 GGTGCCAAGAACATACACTGGGG - Intronic
1052485840 9:29099107-29099129 GATTCCAATTACATACACTGGGG + Intergenic
1052539233 9:29786619-29786641 GTTTCCAAGAACATACACTAGGG + Intergenic
1052644547 9:31216164-31216186 GGTGCCAAGAACATACACTGGGG - Intergenic
1052694776 9:31863566-31863588 GGCACCAAGAACATACAGTGGGG - Intergenic
1052733226 9:32313887-32313909 GGCGCCAAGAACATGCACTGAGG + Intergenic
1052748055 9:32460752-32460774 AACAACAAAAAAATACACTGGGG + Intronic
1052777987 9:32752665-32752687 CATTCCCAGAAAATCCACTGTGG + Intergenic
1053600341 9:39603457-39603479 GCCTCCAGGAAAATAAAGTGTGG + Intergenic
1053617671 9:39785105-39785127 GGCCCTAAGAACATACACTGGGG - Intergenic
1053661130 9:40280453-40280475 GGTGCCAAGAACATACACTGGGG - Intronic
1053857992 9:42357313-42357335 GCCTCCAGGAAAATAAAGTGTGG + Intergenic
1053875853 9:42544472-42544494 GGCCCTAAGAACATACACTGGGG - Intergenic
1053911504 9:42909790-42909812 GGTGCCAAGAACATACACTGGGG - Intergenic
1054235846 9:62557250-62557272 GGCCCTAAGAACATACACTGGGG + Intergenic
1054253187 9:62738927-62738949 GCCTCCAGGAAAATAAAGTGTGG - Intergenic
1054266490 9:62922327-62922349 GGCCCTAAGAACATACACTGGGG + Intergenic
1054373247 9:64426668-64426690 GGTGCCAAGAACATACACTGGGG - Intergenic
1054523480 9:66095831-66095853 GGTGCCAAGAACATACACTGGGG + Intergenic
1054549986 9:66591777-66591799 GGCCCTAAGAACATACACTGGGG + Intergenic
1054567303 9:66773426-66773448 GCCTCCAGGAAAATAAAGTGTGG - Intergenic
1054680880 9:67916446-67916468 GGTGCCAAGAACATACACTGGGG - Intergenic
1054733351 9:68724135-68724157 GGCACCAAGAACATACACTGGGG - Intronic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1055229698 9:74047363-74047385 GACACCAAGAATACACAATGAGG - Intergenic
1055243379 9:74211899-74211921 GGTGCCAAGAACATACACTGGGG - Intergenic
1055394537 9:75860034-75860056 ACCTCCAAGAAAATCCTCTGAGG - Intergenic
1055684745 9:78759500-78759522 GGCACCAAGAACATACACTGGGG + Intergenic
1056288530 9:85116243-85116265 GACGCCAAGAACATTCATTGGGG - Intergenic
1056374686 9:85996108-85996130 AACTCAAAGAAAAAACTCTGAGG - Intronic
1056879408 9:90376551-90376573 GAATCCAACAACATACACCGTGG + Intergenic
1057295712 9:93837872-93837894 GGCACAAAGAACATACACTGCGG - Intergenic
1057463720 9:95292178-95292200 GGCGCCAAGAACACACACTGGGG + Intronic
1058016765 9:100041781-100041803 GGTTCCAAGAACACACACTGGGG + Intronic
1058103489 9:100942906-100942928 GATGCCAAGAACATACAATGGGG - Intergenic
1058256713 9:102775842-102775864 GGTGCCAAGAACATACACTGGGG - Intergenic
1058286967 9:103190438-103190460 TACACCGTGAAAATACACTGTGG + Intergenic
1058384859 9:104423319-104423341 GGTGCCAAGAACATACACTGGGG + Intergenic
1058413511 9:104761606-104761628 GGTGCCAAGAACATACACTGGGG + Intergenic
1058489325 9:105479508-105479530 TATTCCAAGAAAATACACAGAGG - Intronic
1058619632 9:106869289-106869311 GGCTCCAAGAAGATACACGGAGG - Intronic
1058728841 9:107830034-107830056 GGCACCAAGAACATACACCGGGG - Intergenic
1058768198 9:108203911-108203933 GGTGCCAAGAACATACACTGAGG + Intergenic
1058768610 9:108208191-108208213 GACTGCAAGGAAATACACTGAGG + Intergenic
1059502393 9:114766420-114766442 GATCCCAAGAAAATACTCTGTGG + Intergenic
1059667190 9:116459131-116459153 GGTGCCAAGAAAATACAGTGGGG + Intronic
1059876655 9:118642774-118642796 AACTCAAAGAAAATACTCTATGG - Intergenic
1060037422 9:120267881-120267903 GGTGCCAAGAATATACACTGAGG + Intergenic
1060167129 9:121427104-121427126 GACACCAAGAACATACCTTGGGG + Intergenic
1060805205 9:126571121-126571143 GACCCCTAGAAATTGCACTGAGG + Intergenic
1061190991 9:129082555-129082577 CACTCCAAGAAGCTACTCTGAGG - Intronic
1061638708 9:131934003-131934025 GATGCCAAGAACATACATTGGGG + Intronic
1061981457 9:134106489-134106511 GGTTCCAAGAACATACAATGGGG + Intergenic
1203538294 Un_KI270743v1:63277-63299 GATTCCAAGAATATACATGGGGG - Intergenic
1186001166 X:5012569-5012591 GGCACCAAGAACATACATTGGGG + Intergenic
1186110497 X:6250027-6250049 GAATCCAAGTACATACACTTTGG - Intergenic
1186888964 X:13941414-13941436 AACACAAAGAAAATACACTATGG + Intergenic
1187090827 X:16094929-16094951 GGTGCCAAGAACATACACTGGGG - Intergenic
1187610270 X:20935491-20935513 GGTGCCAAGAACATACACTGGGG - Intergenic
1187617303 X:21011224-21011246 TATGCCAAGAACATACACTGGGG + Intergenic
1187669120 X:21651102-21651124 CACTGGAAGAAAATACCCTGGGG - Intronic
1188045188 X:25417666-25417688 GGTGCCAAGAACATACACTGGGG - Intergenic
1188076191 X:25777977-25777999 GGTGCCAAGAACATACACTGGGG - Intergenic
1188094452 X:26004310-26004332 GGTGCCAAGAACATACACTGGGG + Intergenic
1188265612 X:28069675-28069697 GGTACCAAGAACATACACTGGGG - Intergenic
1188598353 X:31928942-31928964 GATGCCATGAAAATACAGTGGGG + Intronic
1188723650 X:33552809-33552831 GGCACCAAGAACATACACTGGGG + Intergenic
1188728879 X:33621287-33621309 TGCTCCTATAAAATACACTGAGG + Intergenic
1188741690 X:33791124-33791146 GGTACCAAGAAAATACACTGGGG - Intergenic
1188831582 X:34904765-34904787 GTCACCAAGAACATACATTGGGG + Intergenic
1188916317 X:35915905-35915927 GGTGCCAAGAACATACACTGGGG + Intergenic
1188996501 X:36892898-36892920 GACACCAAGAACATATATTGGGG + Intergenic
1189032502 X:37464748-37464770 GACCCCTAGAAATTTCACTGAGG + Intronic
1189136006 X:38550901-38550923 GTTCCCAAGAACATACACTGGGG - Intronic
1189405133 X:40715289-40715311 AGCACCAAGAACATACACTGGGG + Intronic
1189628598 X:42926748-42926770 GTTGCCAAGAACATACACTGGGG + Intergenic
1189713629 X:43841785-43841807 GATTCCAAGAACACACAATGGGG + Intronic
1189858176 X:45244873-45244895 GGTGCCAAGAACATACACTGGGG - Intergenic
1189870450 X:45376907-45376929 GGCGCGAAGAACATACACTGGGG + Intergenic
1189873802 X:45413035-45413057 GATGCCAAGAACATACACTAGGG - Intergenic
1189881110 X:45493238-45493260 GATGCCAAGAGCATACACTGGGG - Intergenic
1189923390 X:45926301-45926323 GGTACCAAGAACATACACTGGGG + Intergenic
1190255126 X:48756758-48756780 GACTCCTAGAAATTTCACTGAGG - Intergenic
1190558389 X:51661768-51661790 CATGCCAAGAACATACACTGGGG - Intergenic
1190642074 X:52489760-52489782 GGTGCCAAGAACATACACTGGGG - Intergenic
1190645599 X:52523106-52523128 GGTGCCAAGAACATACACTGGGG + Intergenic
1190820782 X:53969849-53969871 GGCACCAAGAACATTCACTGGGG + Intronic
1190961082 X:55248554-55248576 GACTCCAAGAATATGCACTGGGG + Intronic
1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG + Intergenic
1191630100 X:63313027-63313049 GACCCCTAGAAATTTCACTGAGG + Intergenic
1191650749 X:63535266-63535288 GGTACCAAGAACATACACTGGGG + Intergenic
1191757910 X:64614304-64614326 GGTGCCAAGAACATACACTGGGG - Intergenic
1191801328 X:65083985-65084007 GATGCTAAGAACATACACTGGGG + Intergenic
1191930138 X:66363362-66363384 GACAACAAGAACATACATTGAGG - Intergenic
1191972883 X:66837587-66837609 GGTTCCAGGAACATACACTGGGG + Intergenic
1192074134 X:67973619-67973641 GGTGCCAAGAACATACACTGGGG + Intergenic
1192410083 X:70926323-70926345 GACTCCAAGAATATGCAGTTTGG + Intronic
1192530569 X:71879930-71879952 ACTTCCAAGAACATACACTGGGG + Intergenic
1192990183 X:76444087-76444109 GGCTTCAAGAACATATACTGAGG - Intergenic
1193020712 X:76789986-76790008 GATACCAAGAACATACATTGGGG + Intergenic
1193064228 X:77241085-77241107 GGTGCCAAGAACATACACTGGGG + Intergenic
1193163267 X:78253459-78253481 GTTTCCAAGAAAATACACTGGGG - Intergenic
1193167361 X:78296162-78296184 GTTGCCAAGAACATACACTGGGG - Intronic
1193232486 X:79064819-79064841 AATGCCAAGAACATACACTGTGG - Intergenic
1193243650 X:79203315-79203337 GGTGCCAAGAACATACACTGGGG + Intergenic
1193267737 X:79493692-79493714 TTCTCCAAGAAAACACACTGAGG + Intergenic
1193335755 X:80286798-80286820 GGCACCAAGAACATACACTGGGG + Intergenic
1193375060 X:80749968-80749990 GATTCCAAGAACACACAATGGGG + Intronic
1193410273 X:81154239-81154261 GCTGCCAAGAATATACACTGGGG + Intronic
1193421528 X:81289152-81289174 GGTGCCAAGAACATACACTGGGG + Intronic
1193476958 X:81978098-81978120 TACCTGAAGAAAATACACTGTGG - Intergenic
1193490047 X:82137928-82137950 GTTGCCAAGAACATACACTGGGG + Intergenic
1193506798 X:82354269-82354291 GACAACAAGAATATACATTGGGG + Intergenic
1193562548 X:83037308-83037330 GGCACCAAGAACATACACTGAGG + Intergenic
1193626441 X:83827449-83827471 TATACCAAGAACATACACTGCGG + Intergenic
1193691556 X:84651447-84651469 GGTACCAAGAACATACACTGAGG - Intergenic
1193754990 X:85397765-85397787 GCTGCCAAGAACATACACTGGGG - Intergenic
1193761323 X:85469982-85470004 GGTGCCAAGAAAATACACTGGGG - Intergenic
1193773178 X:85611998-85612020 GTCTATAAGAAAAGACACTGGGG + Intergenic
1193867675 X:86756000-86756022 GGCACCAAGAATATACATTGGGG - Intronic
1193913472 X:87335009-87335031 GGCACCAAGAACATACACTGGGG - Intergenic
1193982043 X:88193407-88193429 GGTGCCAAGAAAATACACTCGGG + Intergenic
1194055838 X:89129918-89129940 GGTGCCAATAAAATACACTGAGG - Intergenic
1194063156 X:89229434-89229456 GCTGCCAAGAACATACACTGGGG + Intergenic
1194247223 X:91530274-91530296 GATGCCAAGAACATACACTGGGG - Intergenic
1194256764 X:91644887-91644909 GGTACCAAGAACATACACTGAGG - Intergenic
1194392945 X:93343973-93343995 GATACCAAGAACATACACTGGGG - Intergenic
1194418350 X:93640765-93640787 GATGCCAAGAACATACACTGGGG + Intergenic
1194513481 X:94822681-94822703 GACTCCTAGAAATTTTACTGAGG + Intergenic
1194692431 X:97004052-97004074 GATGCCAAGAACATACATTGGGG - Intronic
1194783411 X:98052535-98052557 GATGCCAAGAACATACACTAGGG - Intergenic
1195002831 X:100658373-100658395 GCCATCAAGAACATACACTGGGG - Intronic
1195178086 X:102329937-102329959 TAGTCCAAAAAAATACATTGTGG + Intergenic
1195180778 X:102357156-102357178 TAGTCCAAAAAAATACATTGTGG - Intergenic
1195495813 X:105531821-105531843 GATGCCAAGAACAAACACTGGGG - Intronic
1195562883 X:106304630-106304652 GATACCAAGAAAATACATTGGGG - Intergenic
1195592295 X:106643594-106643616 GGTGCCAAGAACATACACTGGGG - Intronic
1195612113 X:106879421-106879443 GACACCAAGAACGTACATTGAGG + Intronic
1195814006 X:108865760-108865782 GTTTCCAAGAACATACACTGTGG - Intergenic
1195844849 X:109215536-109215558 GATACCAAGAACATACACTGGGG + Intergenic
1195943640 X:110186627-110186649 GATTCCAAGAACATTCAATGGGG + Intergenic
1195982872 X:110598830-110598852 GATGCCAAGAACATACATTGGGG - Intergenic
1196114526 X:111984533-111984555 GACTCCAAGAAATTTTACTGAGG + Intronic
1196128379 X:112124853-112124875 TACTCCAAGAAAATACATCAAGG - Intergenic
1196248894 X:113434652-113434674 GGTGCCAAGAATATACACTGGGG + Intergenic
1196316030 X:114224937-114224959 GGTGCCAAGAACATACACTGAGG + Intergenic
1196481239 X:116152124-116152146 GATGACAAGAACATACACTGGGG + Intergenic
1196538565 X:116877653-116877675 GGTGCCAAGAACATACACTGGGG - Intergenic
1196598870 X:117577945-117577967 GCGTCCAAGAACATATACTGGGG - Intergenic
1197071342 X:122301466-122301488 CAATCCAAGAAAATACATTGAGG - Intergenic
1197076145 X:122355417-122355439 GGTGCCAAGAACATACACTGGGG + Intergenic
1197096479 X:122602781-122602803 GATGCCAAGAATATACAATGGGG + Intergenic
1197408844 X:126090825-126090847 GGTGCCAAGAACATACACTGGGG + Intergenic
1197440401 X:126481539-126481561 GATGCCAAGAACATACAGTGGGG + Intergenic
1197564535 X:128065791-128065813 GGTACCAAGAACATACACTGAGG + Intergenic
1197587125 X:128362507-128362529 GATGCCAAGAACATAAACTGGGG - Intergenic
1197684416 X:129424081-129424103 GGTACCAAGAACATACACTGGGG - Intergenic
1197810614 X:130439108-130439130 GGTGCCAAGAACATACACTGGGG - Intergenic
1198007446 X:132511195-132511217 GGCACCAAGAACATACATTGGGG + Intergenic
1198192649 X:134325219-134325241 GGCGTCAAGAACATACACTGGGG - Intergenic
1198294134 X:135268975-135268997 GGTGCCAAGAACATACACTGGGG + Intronic
1198315926 X:135466111-135466133 GGTGCCAAGAACATACACTGGGG + Intergenic
1198701224 X:139399856-139399878 GACTCCTAGAAATTTTACTGAGG - Intergenic
1198702173 X:139408793-139408815 GATGCCAAGAACATACATTGGGG - Intergenic
1198735459 X:139780152-139780174 TACTCCAAGAAAAATCAGTGAGG + Intronic
1198781359 X:140239553-140239575 GATGCCAAGAACATGCACTGGGG - Intergenic
1198783109 X:140258232-140258254 GACTCCTAGAAATTTTACTGAGG + Intergenic
1198785066 X:140278210-140278232 GGTACCAAGAACATACACTGGGG - Intergenic
1198787874 X:140310979-140311001 GGTTCCAAAAACATACACTGGGG + Intergenic
1198813036 X:140555413-140555435 GGCACCAAGAACATACAATGGGG + Intergenic
1198843335 X:140882097-140882119 GAAGTCAAGAACATACACTGGGG + Intergenic
1198882550 X:141296621-141296643 GGTGCCAAGAACATACACTGGGG + Intergenic
1198931122 X:141861653-141861675 GCCATCAAGAACATACACTGGGG + Intronic
1198938526 X:141926322-141926344 GATTCCAAGAACATACATTGAGG - Intergenic
1199032761 X:143020177-143020199 GGTTCCAAGAACATATACTGGGG + Intergenic
1199153661 X:144520203-144520225 GGTGCCAAGAACATACACTGGGG - Intergenic
1199176384 X:144792276-144792298 GACTTCAAGAAAATAGACTGGGG + Intergenic
1199203230 X:145118019-145118041 GTTGCCAAGAATATACACTGGGG + Intergenic
1199327428 X:146515494-146515516 GGTACCAAGAACATACACTGAGG - Intergenic
1199333874 X:146595445-146595467 GATCCCAAGAATATACACTAGGG - Intergenic
1199404942 X:147445693-147445715 GATGCCAAGAACCTACACTGGGG - Intergenic
1199441440 X:147872756-147872778 GGTGCCAAGAACATACACTGGGG + Intergenic
1200566243 Y:4771812-4771834 GATGCCAAGAACATACACTGGGG - Intergenic
1200575483 Y:4884152-4884174 GGTACCAAGAACATACACTGAGG - Intergenic
1200717335 Y:6563539-6563561 GCTGCCAAGAACATACACTGGGG + Intergenic
1201485694 Y:14492370-14492392 GAATCCAAGTAAATACACTTTGG + Intergenic
1201867346 Y:18669441-18669463 GACCCCAACAAGATCCACTGGGG - Intergenic
1201941358 Y:19463669-19463691 GACACCAATAACACACACTGGGG + Intergenic