ID: 1016642904

View in Genome Browser
Species Human (GRCh38)
Location 6:146370781-146370803
Sequence CAAATGAGGGGACGTGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016642904_1016642908 8 Left 1016642904 6:146370781-146370803 CCATCTACACGTCCCCTCATTTG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1016642908 6:146370812-146370834 ACACAATTAACTGCACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016642904 Original CRISPR CAAATGAGGGGACGTGTAGA TGG (reversed) Intronic
901892990 1:12284045-12284067 TAAATGAGGTGATGTGTGGAAGG + Intronic
901928669 1:12583259-12583281 TAAGTGAGGGGATGGGTAGATGG - Intronic
903763379 1:25715364-25715386 GGAAGGAGGGGAGGTGTAGAAGG + Intronic
906793497 1:48678549-48678571 CAAAAGAGGGCATGTGTGGAGGG - Intronic
920196917 1:204234188-204234210 AAAATGAGGTGATGTGAAGATGG + Intronic
920307381 1:205027639-205027661 CAATTCGGGGGACGTGAAGAAGG - Intergenic
922096304 1:222445881-222445903 CAGATGAGGGGACATGAGGAGGG - Intergenic
923514373 1:234682144-234682166 CAAAAGTGGGGAGGAGTAGACGG + Intergenic
1062813893 10:485244-485266 CACATGAGGGCACCTGCAGAGGG + Intronic
1062936305 10:1392978-1393000 CAAATGTGGGGACTTTGAGAAGG - Intronic
1063913545 10:10856672-10856694 TAAATGAGTGCACGAGTAGAAGG - Intergenic
1063991551 10:11570148-11570170 CAAATGAGGGAAAGTTAAGAGGG + Intronic
1067257880 10:44661835-44661857 CACATGAGGGGAAGTGGGGATGG - Intergenic
1070275369 10:75001011-75001033 TAAAAAAGGGGACATGTAGAAGG - Intronic
1070304664 10:75233271-75233293 CCTATGAGGGGAGGTGGAGAAGG - Intergenic
1070526288 10:77298681-77298703 CAAATGAGGGGACCTTTGGGAGG - Intronic
1074027123 10:109647848-109647870 TAAATGAGGTCACGTGTAGCAGG - Intergenic
1074736392 10:116438574-116438596 CAAATGGAGGGAAGTGGAGAAGG - Intronic
1076438347 10:130461934-130461956 CAAATGTGGGGAGGTGGTGACGG + Intergenic
1080454183 11:32403394-32403416 CAAATGGGGGTTGGTGTAGATGG - Intronic
1081998587 11:47379586-47379608 CAGATGAGTGGATGGGTAGATGG - Intergenic
1084860020 11:72012162-72012184 CAAATGAGAGAAGGTGCAGAAGG + Intronic
1087958127 11:104315399-104315421 CACATGAGGGGAACTGTTGATGG + Intergenic
1088022929 11:105141599-105141621 CAAATGAGGTGAATTGGAGAGGG + Intergenic
1092274104 12:7046305-7046327 CAAATTAGGGGACATGCACAGGG - Intronic
1095192084 12:39269837-39269859 AAAGTGAGGGGCTGTGTAGAAGG - Intergenic
1095733510 12:45532027-45532049 CAAATGAGGGGAGGAGTAGGGGG + Intergenic
1096587143 12:52630081-52630103 CAAGTGAGGGAAAGTCTAGAGGG + Intergenic
1097248556 12:57620050-57620072 CAGATGAGGGGAGGTGGGGATGG - Exonic
1104529658 12:129557367-129557389 GAAATGAGGAGACGTGTTTAAGG + Intronic
1108135175 13:47349065-47349087 AAAATGAGGGGAGGTGGAGGGGG + Intergenic
1108180074 13:47831992-47832014 TAAAGGAGGGGATGGGTAGAGGG - Intergenic
1108210417 13:48134037-48134059 AAAATGAGGGGAAGTGGGGAAGG - Intergenic
1111466470 13:88618657-88618679 CAAATAAGGGGACAAGTAGTTGG - Intergenic
1116040478 14:39680173-39680195 TAAATGAGCTGACATGTAGAGGG - Intergenic
1116118713 14:40694218-40694240 CAGATGAGGGGACTTGCACATGG - Intergenic
1117285196 14:54279955-54279977 CTAAGGAGGGGAAATGTAGAGGG + Intergenic
1119969106 14:78949428-78949450 CAAATGAGTGGATGGGTTGAGGG - Intronic
1122468700 14:101951314-101951336 TGAATGAGGGGAGGTTTAGAGGG + Intergenic
1126424443 15:48511611-48511633 TAAGTGAGGGGCCGAGTAGAAGG - Intronic
1126831864 15:52615826-52615848 TAAATCAGTTGACGTGTAGAAGG - Intronic
1130847047 15:87757291-87757313 CAAGTGAGAGGATGTGTGGAGGG - Intergenic
1137505519 16:49050908-49050930 GAAATGAGGTGATGTGTACAAGG - Intergenic
1141435962 16:83999820-83999842 TAAATGAGAGGACAAGTAGAAGG + Intronic
1142812095 17:2400198-2400220 CAGATGAACGGACGTGTACACGG - Intronic
1143573566 17:7776494-7776516 GAAATGAGGGAACGAGAAGATGG + Intronic
1148148086 17:45378666-45378688 CAAATAAAGGGATGTGTGGATGG + Intergenic
1151424013 17:74018045-74018067 CCATGGAGGGGACGTGTATAAGG + Intergenic
1151804517 17:76397210-76397232 GACAAGAGGGGACATGTAGAAGG + Intronic
1153189042 18:2517738-2517760 CAAATCCAGGGACATGTAGATGG - Intergenic
1155692608 18:28644363-28644385 CAAATGAGGGAATATGCAGATGG + Intergenic
1155798143 18:30065981-30066003 CAGAAGAGGGGAACTGTAGAGGG - Intergenic
1158199210 18:54921571-54921593 CAAATGAGGGGCCTGGGAGAAGG + Intronic
1159868799 18:73737176-73737198 CAAATGAGTGCATGTATAGACGG - Intergenic
1160157698 18:76446129-76446151 CAGAGGAGGGGACGAGTTGAGGG - Intronic
1160384565 18:78487153-78487175 CCAATGAGGTGATGTGGAGAAGG + Intergenic
1163675838 19:18654852-18654874 CAAATGAATGGACAGGTAGATGG - Intronic
1164597804 19:29541628-29541650 AAAATGAGTGGATGGGTAGATGG + Intronic
1167315143 19:48758399-48758421 CACGTGAGGGGAGGTGTAGAGGG - Intergenic
1168678073 19:58293495-58293517 CAGATGAGGGGGCTTGAAGAGGG + Intronic
926234236 2:11027422-11027444 CAGAGAAGGGGACGTGAAGAAGG - Intergenic
929657960 2:43752985-43753007 CAAATAAGGGGAGGGGGAGAAGG - Intronic
937235812 2:120431337-120431359 CAAGTGAAGGGAAATGTAGATGG + Intergenic
938671363 2:133589460-133589482 CAAATGAGGAGACGTCCAGGGGG + Intergenic
942875609 2:180793152-180793174 GAGATGAGGGGAGGTGAAGAAGG - Intergenic
943049438 2:182897232-182897254 TGAATGAGGGGACGGGTAGTGGG - Intergenic
944108573 2:196106512-196106534 CAAGTGCAGGGACATGTAGATGG + Intergenic
944264866 2:197711934-197711956 CTAATGAGGGTACATGTACAAGG - Intronic
946384517 2:219374494-219374516 AAAATGAGGGGATGGGAAGAGGG - Intronic
948190140 2:236051918-236051940 CTATTGAGGGGACGTGCAGGAGG - Intronic
1173964243 20:47099612-47099634 CAGTTGAGGGGACGTGGAGCTGG + Intronic
1182739659 22:32558577-32558599 CAGATGAGGGGAAGTGGGGAAGG - Intronic
1184414738 22:44345698-44345720 CAAATGAGTGGTTGGGTAGATGG + Intergenic
949281915 3:2355970-2355992 CAACTGAGGGGAGGTCTGGAAGG - Intronic
954092816 3:48298704-48298726 CAAGGGAGGGGAGTTGTAGAGGG + Intronic
957923314 3:86775449-86775471 CAAATGAGGAGAGGTGGAGAGGG - Intergenic
958548198 3:95583907-95583929 CAAGTGTGGTGAAGTGTAGAAGG - Intergenic
962322368 3:134402436-134402458 TAAATGAGGTGATGTATAGAAGG + Intergenic
968403258 4:316801-316823 CAAATGAGAGGAGGTGCAGTGGG + Intergenic
969205361 4:5640036-5640058 CAGATGGGTGGACGGGTAGATGG + Intronic
983745828 4:171199062-171199084 CAAATGAGGAGAAGGGTGGATGG - Intergenic
984242819 4:177237749-177237771 CTAATGAGGTGACGTGGAAAGGG - Intergenic
985039285 4:185872833-185872855 AAAATAATGGGAGGTGTAGAGGG - Intronic
985696017 5:1340602-1340624 CAGATGAGGGGACACGGAGAGGG + Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
989089641 5:37716764-37716786 CAAATAAGGGGAGGAGGAGAAGG - Intronic
992515494 5:77487992-77488014 CAAATGAGAGGATGTATATAGGG - Intronic
994153488 5:96475775-96475797 CAAAAGAGGGGACCTGTGGCTGG + Intergenic
994867572 5:105296615-105296637 CAAATGAGGAAACTTGTTGAGGG - Intergenic
999005400 5:147970996-147971018 CAAATGAGGAAGAGTGTAGAAGG - Intergenic
1001257153 5:170192878-170192900 CAAATGAGGGGAGCAGAAGAAGG + Intergenic
1002256321 5:177960975-177960997 CAAATGAGAAGACGTGGAGCAGG + Intergenic
1009687465 6:66981766-66981788 CAAATGAGAGGATGTGAAGAAGG - Intergenic
1010373204 6:75135623-75135645 AAAATGAGTGCACATGTAGATGG + Intronic
1013309317 6:108879033-108879055 CAGATGAGTGGATGAGTAGATGG - Intronic
1013605510 6:111743824-111743846 CAAATGAGGGGCCGTGAATGTGG - Intronic
1013640292 6:112069514-112069536 CAAATGAGGGGTCATTTAAATGG + Exonic
1014512852 6:122345981-122346003 CTGATGGGGTGACGTGTAGAAGG - Intergenic
1015042958 6:128743490-128743512 TAAAAGAGGGGACTGGTAGATGG + Intergenic
1015704643 6:136074575-136074597 CAAATGCTGGGAAGTGTAGTGGG - Intronic
1016642904 6:146370781-146370803 CAAATGAGGGGACGTGTAGATGG - Intronic
1020993283 7:15229482-15229504 AGGATGAGGGGATGTGTAGATGG - Intronic
1024420361 7:49158785-49158807 CAAATGAGGGCACATTAAGAAGG + Intergenic
1031951759 7:127899947-127899969 CAGATGAGGAGACGTGTTCAGGG + Intronic
1035217892 7:157383490-157383512 CAAATGAGAGGATCTGTTGAGGG - Intronic
1038075638 8:24070253-24070275 AAAGTGAGGGGAGGTGGAGAAGG - Intergenic
1039027925 8:33278214-33278236 CTAAGGAGGAGACGTGTGGATGG - Intergenic
1190339825 X:49287250-49287272 GAGATGAGGGAACGGGTAGATGG + Exonic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1199047434 X:143193063-143193085 CAAATGAGGACACAGGTAGAAGG - Intergenic